ID: 966039731

View in Genome Browser
Species Human (GRCh38)
Location 3:175467303-175467325
Sequence ATAAGCCATCTCAGCAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966039731_966039732 -10 Left 966039731 3:175467303-175467325 CCTAATTTGCTGAGATGGCTTAT 0: 1
1: 0
2: 1
3: 19
4: 273
Right 966039732 3:175467316-175467338 GATGGCTTATAATAATAATATGG 0: 1
1: 0
2: 0
3: 24
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966039731 Original CRISPR ATAAGCCATCTCAGCAAATT AGG (reversed) Intronic
900812783 1:4820729-4820751 TTAAGCAATGTCAGCAAAATAGG + Intergenic
901606427 1:10462758-10462780 AGAAGCCATCTCAGAAGATTGGG + Intronic
903272649 1:22200742-22200764 AAAACACCTCTCAGCAAATTAGG - Intergenic
903808020 1:26019269-26019291 ATCTGTCATCTCAGCAATTTGGG - Intergenic
905963921 1:42072874-42072896 ATAAAAACTCTCAGCAAATTAGG - Intergenic
914927724 1:151903169-151903191 AGAACCCAGCTCAGAAAATTTGG + Intronic
917469305 1:175313045-175313067 ATAAGACATCACCACAAATTAGG - Intergenic
919185326 1:194139626-194139648 ATAAACACTCTCAGCAAATTAGG + Intergenic
919198898 1:194326261-194326283 ATAACCCACCTCAGAACATTGGG - Intergenic
920642388 1:207765270-207765292 ATAAAACTTCTCAGCAAACTAGG + Intronic
922414711 1:225410547-225410569 ATAAGACATCTCAGCACCATGGG + Intronic
924786030 1:247200818-247200840 ATAAGCCATCACATTTAATTAGG - Intergenic
1062801106 10:381159-381181 CTAATTCATCTCAGGAAATTAGG + Intronic
1063917677 10:10900518-10900540 ATAAAGAATCTCAGCAAACTAGG + Intergenic
1064843857 10:19629026-19629048 ACAATCCAGCTCTGCAAATTAGG - Intronic
1067769156 10:49111058-49111080 ACAAGCCTTCTCAGCAAAGCTGG + Intronic
1069859792 10:71463280-71463302 ATGTGCCATCTCACCAAATGAGG - Intronic
1070684978 10:78473459-78473481 AAAAGCCATTTCATCAAATGTGG + Intergenic
1071340898 10:84647504-84647526 ATAAGCAACTTCAGCAAAGTCGG - Intergenic
1071588745 10:86850754-86850776 GTAATCCATCTCAGCACTTTAGG - Intronic
1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG + Intronic
1072020897 10:91399878-91399900 ATAAGAACTCTCAACAAATTAGG + Intergenic
1072304715 10:94096063-94096085 TGAAGCCATCTCAGCAATCTGGG - Intronic
1073985825 10:109207795-109207817 AAAAGCCATCTCAAAAATTTAGG - Intergenic
1074627286 10:115204467-115204489 ATAAAAACTCTCAGCAAATTAGG - Intronic
1075332420 10:121583396-121583418 ATGAGCCATCTCAGCAGAGCAGG - Intronic
1076668507 10:132106073-132106095 ATGAGTCATCCCAGCACATTAGG + Intronic
1077381679 11:2244927-2244949 ATAAAAACTCTCAGCAAATTAGG + Intergenic
1078637909 11:13069051-13069073 ATCAGCCAACTCAGCATGTTAGG - Intergenic
1080881942 11:36329589-36329611 ATAAGTCATCTCATTAAATATGG + Intronic
1081404921 11:42686935-42686957 ATAAAAACTCTCAGCAAATTCGG + Intergenic
1082089099 11:48074836-48074858 ATATGAGATTTCAGCAAATTAGG + Intronic
1082649244 11:55767943-55767965 ATCAGCTATCTTAGCACATTAGG - Intergenic
1083483709 11:62968128-62968150 ATAAAACTTCTCAGCAAACTAGG + Intronic
1083980971 11:66169218-66169240 ATAAGTCCTCTTAGCAAACTTGG - Intronic
1086911381 11:92476340-92476362 ATAAGCCATCTAAGTACATTTGG + Intronic
1087133350 11:94689415-94689437 ATAAAAACTCTCAGCAAATTAGG + Intergenic
1087637911 11:100723937-100723959 ATAAAAACTCTCAGCAAATTAGG - Intronic
1089423841 11:118353242-118353264 AAAGGCCATCAGAGCAAATTTGG + Exonic
1089944578 11:122455383-122455405 ATAAGAACTCTCAACAAATTAGG + Intergenic
1090089927 11:123687002-123687024 ATAAGAACTCTCAGCAAATTAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1091708421 12:2717332-2717354 AAAACACCTCTCAGCAAATTAGG + Intergenic
1094345325 12:29461666-29461688 CTCTGACATCTCAGCAAATTCGG + Intronic
1095896968 12:47289443-47289465 AAATGCCATCTCCTCAAATTAGG + Intergenic
1096437600 12:51607611-51607633 ATGATCCCTCTCAGCAAAATCGG - Intronic
1098341531 12:69456474-69456496 AAAAGCCATCACAGTAAATCAGG + Intergenic
1098880670 12:75914007-75914029 ATAGGCCATATGAGCAAATCTGG + Intergenic
1099576206 12:84385427-84385449 ATAAATAATCTCAGCAAACTAGG - Intergenic
1100079814 12:90834906-90834928 ATAAGCCTTATCTGAAAATTTGG + Intergenic
1102319784 12:111922359-111922381 ATAAAGCCTCTCAGCAAACTAGG + Intergenic
1102556874 12:113732570-113732592 ATAATCCATCCCAGCACTTTGGG + Intergenic
1103128127 12:118442516-118442538 ATTAGTCATCACAGCAACTTGGG + Intergenic
1103256230 12:119543737-119543759 ATAAGCCATGTTAGGAAGTTTGG + Intergenic
1104213111 12:126709313-126709335 ATCAGTAATCTCAGCAATTTGGG - Intergenic
1105346926 13:19581756-19581778 ACATGGCATCTCAGCATATTTGG + Intergenic
1105630910 13:22166519-22166541 ATAGGCCATAGCAGCAAAATTGG - Intergenic
1108988568 13:56626475-56626497 ATAAACATTCTCAGCAAACTAGG + Intergenic
1109577639 13:64283102-64283124 ATAAGCCATTTCAGCACATCAGG + Intergenic
1109898885 13:68735822-68735844 ATAAAACCTCTCAGCAAACTAGG - Intergenic
1110123626 13:71913696-71913718 ATCAGCCACCTCAGTAAAGTTGG - Intergenic
1110196667 13:72797003-72797025 AGAAATCATCACAGCAAATTAGG - Intronic
1111449583 13:88397282-88397304 TTAAACACTCTCAGCAAATTAGG + Intergenic
1112930300 13:104727308-104727330 ATAAGAAATCTCAGCAAATTAGG + Intergenic
1113204721 13:107903414-107903436 ATAAAGACTCTCAGCAAATTAGG + Intergenic
1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG + Intronic
1114821349 14:26023275-26023297 ATTAGCCAGCTCAGGAAATAGGG - Intergenic
1114841707 14:26270720-26270742 ATAAGTTTTCTCAGCAAAGTAGG - Intergenic
1116834479 14:49757071-49757093 ATAAGAACTCTCAGCAAACTAGG - Intergenic
1116928880 14:50670052-50670074 ATATTCAATGTCAGCAAATTTGG - Intergenic
1116975137 14:51107547-51107569 ATTAGCCATCTCATACAATTTGG - Intergenic
1117250524 14:53933013-53933035 CTAAGCCATCACAGAAAAATAGG + Intergenic
1117660948 14:58004189-58004211 AGAAGCTCTCTCAGCATATTAGG - Exonic
1118537678 14:66786835-66786857 ATAAGAACTCTCAGCAAACTAGG + Intronic
1122531874 14:102433779-102433801 ATAAGCCATCCTAGCACTTTGGG - Intronic
1123506990 15:20952529-20952551 AGAGCCCATCTCAGGAAATTAGG + Intergenic
1123564217 15:21526280-21526302 AGAGCCCATCTCAGGAAATTAGG + Intergenic
1123600471 15:21963562-21963584 AGAGCCCATCTCAGGAAATTAGG + Intergenic
1124102685 15:26710519-26710541 ATAGGCCATCCCAGCACTTTGGG - Intronic
1126622425 15:50653333-50653355 ATAAGCACTGTCAGCAAACTAGG + Intronic
1127589085 15:60404944-60404966 GTCAGCCATCTCAGTAAAATTGG + Intergenic
1129629903 15:77247374-77247396 ATAAATAATCTCAGCAAACTAGG - Intronic
1202972578 15_KI270727v1_random:253381-253403 AGAGCCCATCTCAGGAAATTAGG + Intergenic
1133134450 16:3700049-3700071 ATAATTTATCTCACCAAATTAGG + Intronic
1134089896 16:11385909-11385931 AAAAGCCATCCCAGCACTTTGGG + Intronic
1134564686 16:15241025-15241047 ATCAGTAATCTCAGCAATTTGGG + Intergenic
1134737812 16:16515674-16515696 ATCAGTAATCTCAGCAATTTGGG - Intergenic
1134851332 16:17481351-17481373 AAAAGCCAGCACAGAAAATTGGG - Intergenic
1135008829 16:18854865-18854887 AGAAGCCATCTCATGGAATTAGG - Exonic
1135236673 16:20763321-20763343 ATAAGACACCTCAGAAAATGAGG + Intronic
1135908278 16:26534941-26534963 ATAACAATTCTCAGCAAATTGGG + Intergenic
1137288599 16:47036735-47036757 AAAACCCATCTGAGCAAAATGGG - Intergenic
1140272129 16:73475704-73475726 ATAAGACATCTCAGTAACTTTGG - Intergenic
1140444817 16:75017289-75017311 ATAAGCCATTTTTGTAAATTTGG + Intronic
1144156101 17:12504773-12504795 ATAAAAGTTCTCAGCAAATTAGG + Intergenic
1145122976 17:20277326-20277348 GTAAGCCATCTTACCCAATTAGG - Intronic
1147562570 17:41518189-41518211 GTATGTAATCTCAGCAAATTTGG - Intronic
1149125226 17:53221549-53221571 ATAAAGCCTCTCAACAAATTAGG + Intergenic
1149300103 17:55297512-55297534 ATTATCCATCTTAGGAAATTAGG + Intronic
1154392393 18:13950602-13950624 ATAAAACCTCTCAGCAAACTAGG - Intergenic
1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG + Intergenic
1156013464 18:32521381-32521403 AAACTCCATCTCAGCACATTGGG + Intergenic
1156101073 18:33595563-33595585 AGAAGCCATTGCAGCAAAATGGG + Intronic
1157249234 18:46079775-46079797 ATAAACCATTTTAGCAATTTAGG - Intergenic
1159677882 18:71308641-71308663 ATAAGACATTACAGTAAATTAGG + Intergenic
1159852714 18:73545185-73545207 ATCAACCATCTCAGAACATTGGG - Intergenic
1159925563 18:74266039-74266061 AGAAGACATTTCAGTAAATTGGG - Intronic
1160009359 18:75092568-75092590 AAAAAACATCTCAACAAATTAGG - Intergenic
1160104193 18:75954747-75954769 ATAAGTAATCTCAACAAATTAGG + Intergenic
1160110214 18:76020982-76021004 ATAAAAACTCTCAGCAAATTAGG + Intergenic
1162716703 19:12638890-12638912 ATAGGCCAACTCAGCAAACGTGG + Intronic
1163323855 19:16590463-16590485 ATAAAACCTCTCAGCAAACTAGG - Intronic
1166267985 19:41696749-41696771 TGAAGCCATCTCAGCAAGTAAGG + Intronic
927647882 2:24890005-24890027 ATAATACCTCTCAGCAAACTAGG - Intronic
929202885 2:39256426-39256448 ATAATACTTCTTAGCAAATTGGG - Intronic
929427100 2:41854764-41854786 ACATGGCATCTCAGAAAATTTGG - Intergenic
933474336 2:82770225-82770247 ATAAAAATTCTCAGCAAATTGGG + Intergenic
933611709 2:84443460-84443482 AAAAGCAATCTTAGCAACTTAGG + Intronic
935381746 2:102459042-102459064 ATAAAACCTCTCAGCAAACTAGG + Intergenic
936120037 2:109733385-109733407 ATAAATACTCTCAGCAAATTAGG + Intergenic
936225632 2:110647562-110647584 AAAAACCCTCTCAGCAAACTAGG + Intronic
938355382 2:130642031-130642053 TGAAGGCAGCTCAGCAAATTCGG + Intronic
938854956 2:135299841-135299863 TTAGGTCATGTCAGCAAATTAGG - Intronic
939793563 2:146612238-146612260 ATAAAAACTCTCAGCAAATTAGG - Intergenic
940600966 2:155859761-155859783 GTAAGCCTTTTCAACAAATTGGG + Intergenic
940935040 2:159483457-159483479 ATAAGGCATCCCAGCACTTTGGG - Intronic
941333943 2:164216726-164216748 ATAAAATATATCAGCAAATTGGG + Intergenic
943089765 2:183360207-183360229 ATAGCCCATCTCATCAAAATAGG - Intergenic
943901574 2:193445137-193445159 ATAAACCACATCAGCTAATTTGG - Intergenic
944392783 2:199235379-199235401 AAAAAACCTCTCAGCAAATTAGG - Intergenic
944601918 2:201311888-201311910 ATAAAAACTCTCAGCAAATTAGG + Intronic
944914981 2:204350450-204350472 ATAAACTCTCTCAGCGAATTGGG - Intergenic
945149721 2:206777354-206777376 ATAAGGGCTCTCAACAAATTAGG - Intronic
945623207 2:212168561-212168583 ATTAGATATATCAGCAAATTAGG + Intronic
945773780 2:214079491-214079513 ATAAGCCATGTTAGAAAGTTTGG + Intronic
948511714 2:238470773-238470795 ATAAACACTCTTAGCAAATTAGG - Intergenic
948651874 2:239450738-239450760 ACAATCCATCTCAGGACATTTGG - Intergenic
1170260055 20:14394763-14394785 ATAAAACTTCTCAGCAAACTTGG - Intronic
1170722295 20:18893629-18893651 ATAAAACCTCTCAGCAAACTAGG + Intergenic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1171098831 20:22362153-22362175 ATAACCAAACTTAGCAAATTAGG + Intergenic
1171933311 20:31248237-31248259 AAAAAACATCTCAGCAAAGTGGG + Intergenic
1173276320 20:41586789-41586811 ATAAAAACTCTCAGCAAATTTGG + Intronic
1173762414 20:45574985-45575007 ATAAAAAATCTCAACAAATTAGG + Intronic
1175411818 20:58775421-58775443 ATACATCTTCTCAGCAAATTAGG + Intergenic
1175867431 20:62187071-62187093 ACAAAACATCTCAGCAAACTGGG - Intronic
1177680535 21:24363300-24363322 ATAAGCCATCTTATAAACTTTGG + Intergenic
1177916710 21:27097741-27097763 ATAAGCCAACACATCAACTTTGG - Intergenic
1178045860 21:28694287-28694309 ATAAGACATTCCTGCAAATTAGG - Intergenic
1178572483 21:33752582-33752604 TTAAGCCATCTCAGAACTTTTGG + Intronic
1179926436 21:44537629-44537651 ACAAGTCATATCAGCAAATGGGG + Intronic
1181461448 22:23088480-23088502 AAAAGGCGTCTCAGCAAACTGGG + Intronic
1181717393 22:24741550-24741572 ACAAACCACCTCAGCAAAATCGG + Intronic
950321737 3:12061364-12061386 ATAAACATTCTCAGCAAACTAGG + Intronic
951213071 3:19997026-19997048 ATAAAACTTCTCAACAAATTAGG + Intronic
951382598 3:22002884-22002906 ATAAAACATCTCAACAAATTAGG + Intronic
952060742 3:29506259-29506281 ATAAAAAATCTCAACAAATTAGG - Intronic
952371005 3:32722722-32722744 ATAATCAATCCCAGCACATTGGG + Intronic
952500423 3:33956508-33956530 ACAATCCATGGCAGCAAATTAGG - Intergenic
952620430 3:35332797-35332819 ATAAAATATCTCAACAAATTAGG - Intergenic
954603007 3:51886423-51886445 ATAAAAACTCTCAGCAAATTAGG - Intergenic
954919099 3:54174412-54174434 AAAAACCATCTCAGCAACTGTGG - Intronic
957449904 3:80366473-80366495 AAAAGCCACCTCAGTAAATAGGG + Intergenic
957914432 3:86669267-86669289 ATAATGTTTCTCAGCAAATTTGG + Intergenic
958820840 3:98971887-98971909 AAAAATCATTTCAGCAAATTAGG + Intergenic
958920874 3:100104023-100104045 AGAGGCCATGTCACCAAATTGGG + Intronic
959301543 3:104608547-104608569 ATAAGGAATCTCAGTAAACTAGG + Intergenic
959895889 3:111605442-111605464 ATAAGCAACATCAGGAAATTGGG + Intronic
960579649 3:119265609-119265631 ATAAAAATTCTCAGCAAATTAGG + Intergenic
961842801 3:129731593-129731615 ATAAGAACTCTTAGCAAATTAGG + Intronic
962839785 3:139222971-139222993 ATAATCCAGCTCAGGAAATCAGG - Intronic
963437015 3:145284431-145284453 ATAAGAACTCTCACCAAATTAGG - Intergenic
963617904 3:147566674-147566696 ATACAACATCTCAGCAAATGAGG - Intergenic
964576087 3:158170148-158170170 ATAAGCCAGGTGAACAAATTAGG - Intronic
965214336 3:165841898-165841920 TTAAGCCAATTCAGTAAATTAGG - Intergenic
965538000 3:169844407-169844429 ATAAGAACTCTTAGCAAATTAGG + Intronic
965876371 3:173327113-173327135 ATAAACACTCTCAGCAAACTAGG - Intergenic
966039731 3:175467303-175467325 ATAAGCCATCTCAGCAAATTAGG - Intronic
966275645 3:178163918-178163940 ATAAAAACTCTCAGCAAATTGGG + Intergenic
967127993 3:186443150-186443172 AAAAGCCATCTCAGCACTTTGGG + Intergenic
967947378 3:194814777-194814799 ATATGCCCTCTCAGCAACTCTGG - Intergenic
969106434 4:4810422-4810444 ATTAGACCTCTCAGAAAATTTGG - Intergenic
969692880 4:8715052-8715074 ATAAGAACTCTCAGCAAACTAGG - Intergenic
970216844 4:13767566-13767588 AAAAGTCATCTCAGCATAATGGG - Intergenic
972366936 4:38384808-38384830 ATAAGCCAGCCTTGCAAATTAGG - Intergenic
973667016 4:53171195-53171217 ATAAGAACTCTCAACAAATTAGG - Intronic
975399281 4:73916067-73916089 ATAAGCGATTTCAGCAACTGTGG + Intergenic
975450263 4:74517627-74517649 AAAAGCCTTTTCAGCAAATAAGG + Intergenic
977309429 4:95366927-95366949 GTAAGCCATCACAGGAATTTAGG + Intronic
978935629 4:114371715-114371737 ATCTGTCATCTCAGCAATTTGGG + Intergenic
978982316 4:114962439-114962461 ATAAATGAGCTCAGCAAATTTGG + Intronic
980194387 4:129569303-129569325 ATGGGCCATAACAGCAAATTGGG + Intergenic
983978886 4:173969877-173969899 ATAAAAACTCTCAGCAAATTAGG - Intergenic
984211893 4:176860200-176860222 ATAAGAACTCTCAACAAATTAGG + Intergenic
984429739 4:179633526-179633548 AAAAACCCTCTCAACAAATTAGG - Intergenic
985298839 4:188465072-188465094 CCATGCCATCTCAGCAATTTGGG - Intergenic
986147809 5:5095650-5095672 TTACACCATCTCAGCAAATCAGG + Intergenic
986890883 5:12303857-12303879 ATAAACACTCTCAACAAATTAGG + Intergenic
987256730 5:16161905-16161927 ATAATCCATCTCAGAAACTGTGG + Intronic
988649660 5:33133997-33134019 ATAAAAAATCTCATCAAATTAGG - Intergenic
989317807 5:40102884-40102906 ACAAACCATCTCAGAAAAATGGG - Intergenic
990747135 5:58969872-58969894 ATAGGCCATCTAAGTAATTTTGG + Exonic
991682507 5:69152972-69152994 AAAAGCCATCTAAGAATATTGGG - Intergenic
994255586 5:97590778-97590800 ATAAACTTTCTCAACAAATTTGG - Intergenic
994427602 5:99612475-99612497 ATAAACTATATCAGCAAATTTGG + Intergenic
995112753 5:108445794-108445816 ATAATCCATGACAGCAAAATGGG - Intergenic
996619192 5:125479547-125479569 ATATCCCATCTCACCCAATTGGG + Intergenic
996958673 5:129217003-129217025 ACAAGCCTTCACAGCAAATTTGG + Intergenic
997617422 5:135259108-135259130 ATAAGAACTCTCAGCAAACTAGG + Intronic
998930320 5:147174280-147174302 GTAATCCATCCCAGCAATTTGGG + Intergenic
1000889114 5:166783395-166783417 ATAATTCATCTCAGGAAACTGGG - Intergenic
1003326052 6:5091867-5091889 ATAAGACATTTAAGGAAATTGGG + Intergenic
1005201246 6:23347258-23347280 ATAAGCCATGTTAACAAATCTGG + Intergenic
1005660628 6:27995529-27995551 ATAAGTCATCTTAGCCAGTTTGG + Intergenic
1007724178 6:43904683-43904705 AAAAAGCTTCTCAGCAAATTTGG - Intergenic
1008133589 6:47746294-47746316 ACAAGCCATCCCAGCAACCTAGG + Intergenic
1009985600 6:70778389-70778411 ATAAACATTCTCAACAAATTAGG - Intronic
1010551593 6:77230088-77230110 AGAGCTCATCTCAGCAAATTTGG + Intergenic
1011566990 6:88685751-88685773 ATAAGTACTCTCAGCAAATAAGG + Intronic
1011853308 6:91657501-91657523 AAAAGCTATCTCAGGAATTTTGG + Intergenic
1012058069 6:94441306-94441328 TTAAGCAATCTCAGCACTTTTGG + Intergenic
1012111480 6:95241001-95241023 ATAACCCATTTGAGCTAATTAGG - Intergenic
1012157293 6:95835517-95835539 AAAAGCCATCTAAGCTATTTTGG - Intergenic
1012289144 6:97429934-97429956 ATAAGAACTCTCAGAAAATTAGG - Intergenic
1012580162 6:100858494-100858516 ATAAAAAATCTCAGCAAACTAGG - Intronic
1012741199 6:103018498-103018520 CTAAGCCCTCTGAGCAACTTGGG - Intergenic
1013161112 6:107546062-107546084 AAAATCCGTCTCAGGAAATTTGG + Intronic
1013936201 6:115597972-115597994 ATAAAAACTCTCAGCAAATTAGG - Intergenic
1016868696 6:148795702-148795724 ATACGTCATCTCAGCAAAGATGG - Intronic
1018496406 6:164350670-164350692 ATAAAACCTCTCAACAAATTTGG + Intergenic
1019904033 7:4047160-4047182 AAAAACCCTCTCAGCAAAGTAGG - Intronic
1020184699 7:5950170-5950192 AAAAGCACCCTCAGCAAATTAGG + Intronic
1020298217 7:6774574-6774596 AAAAGCACCCTCAGCAAATTAGG - Intronic
1020347006 7:7176152-7176174 GTGAGCCATTTCAGCAAAATGGG + Intronic
1021067637 7:16196726-16196748 ATAGGCCTTCTCACCTAATTAGG - Intronic
1022153011 7:27628677-27628699 TTAAGCCATCTCAGCATACATGG + Intronic
1026221627 7:68403033-68403055 ATAAGAACTCTCAGCAACTTGGG + Intergenic
1028679150 7:93505676-93505698 ATAAGCCATGTCTACAAAATAGG + Intronic
1029819130 7:103128523-103128545 ATCAGCCATCTGAGAACATTTGG + Exonic
1029992295 7:104973399-104973421 ATGAGACATCCCAGCAGATTAGG + Intergenic
1031537877 7:122957591-122957613 ATGAGCGATCTCAGCAAAAGAGG - Intergenic
1032812129 7:135430760-135430782 ATAAAATCTCTCAGCAAATTAGG + Intronic
1033853725 7:145530776-145530798 ATAAGCATTTTCAGTAAATTGGG - Intergenic
1034984561 7:155500510-155500532 ACTGGCCATCTCAGCCAATTTGG + Intronic
1036998806 8:13692713-13692735 ATAAGAACTCTCAACAAATTAGG - Intergenic
1037386021 8:18342799-18342821 ATAAAACCTCTCAACAAATTAGG + Intergenic
1038469031 8:27795690-27795712 ATAAGAACTCTCAACAAATTAGG - Intronic
1039934275 8:42026947-42026969 ATAAAACCTCTCAACAAATTAGG - Intronic
1041033636 8:53764480-53764502 ATAAAAACTCTCAGCAAATTAGG + Intronic
1041785975 8:61635093-61635115 AAAAGCCATTTGAGTAAATTAGG - Intronic
1041895714 8:62922854-62922876 CAGAGCCATCTCAGCAAATTAGG - Intronic
1042096425 8:65220920-65220942 ATTAGACATCACAACAAATTGGG - Intergenic
1044219711 8:89655495-89655517 ATAAGAACTCTCAACAAATTAGG + Intergenic
1044746922 8:95379467-95379489 AGAAGCCATCTCAGTAAATGGGG - Intergenic
1044788549 8:95822729-95822751 ATAAGACATCTCAACTACTTTGG - Intergenic
1045155444 8:99464038-99464060 ATAAACACTCTCAGCAATTTTGG + Intronic
1046987719 8:120407993-120408015 ATAAACCATTTCAGGAAATCTGG + Intronic
1050253560 9:3771082-3771104 ATCACCCCTCTAAGCAAATTTGG - Intergenic
1051098527 9:13494456-13494478 AAAAGCTATCTAAGCAAATGAGG - Intergenic
1051131764 9:13870033-13870055 ATAAACACTCTCAACAAATTAGG - Intergenic
1051572494 9:18575869-18575891 ACAAGACAGCTCAGCAAATTAGG + Intronic
1053617724 9:39786081-39786103 AAAAACCCTCTCAACAAATTAGG - Intergenic
1053875909 9:42545449-42545471 AAAAACCCTCTCAACAAATTAGG - Intergenic
1053896751 9:42749191-42749213 AAAAACCCTCTCAACAAATTAGG + Intergenic
1054235790 9:62556273-62556295 AAAAACCCTCTCAACAAATTAGG + Intergenic
1054266436 9:62921351-62921373 AAAAACCCTCTCAACAAATTAGG + Intergenic
1055041649 9:71880587-71880609 ATGAGACTTCTCAGCAATTTTGG + Intronic
1055519541 9:77066528-77066550 ATAAGAACTCTCAGCAAACTAGG - Intergenic
1055555222 9:77466955-77466977 TTAAGCCCTCTCAGCCAGTTAGG + Intronic
1055569024 9:77597803-77597825 ATAATCCATCCCAGCACTTTGGG + Intronic
1056534194 9:87513685-87513707 CTAAGCCATGTCTGGAAATTGGG + Intronic
1056700358 9:88900303-88900325 ATAAAAATTCTCAGCAAATTAGG - Intergenic
1056908581 9:90676538-90676560 ATAAACCATTTTAGCAATTTTGG + Intergenic
1058839672 9:108893942-108893964 ATTGGCCACCTCAGCAAATGTGG - Exonic
1059952299 9:119478292-119478314 ATAAGACTTCTCAGCAAATGAGG + Intergenic
1060545543 9:124457102-124457124 CTGAGCCATCTCAGCATCTTGGG + Intronic
1060620955 9:125065901-125065923 AGAAACCAACTCAGCAAACTAGG + Intronic
1061813382 9:133177101-133177123 ATAAACCATTTTAGCAATTTTGG + Intergenic
1203371342 Un_KI270442v1:308558-308580 ATAGGCCAGCTCAGCACAGTGGG - Intergenic
1187465526 X:19523873-19523895 ATAAAGACTCTCAGCAAATTAGG - Intergenic
1187987212 X:24827387-24827409 AGGAGCCATCTCAGGACATTAGG - Intronic
1190388230 X:49905153-49905175 AAAAAACATCTCAGCAAACTAGG + Intergenic
1191101400 X:56732763-56732785 ATAAAACCTCTCAGCAAACTAGG - Intergenic
1191640162 X:63422824-63422846 ATAAGACTTCTCAACAAATTAGG - Intergenic
1193549044 X:82866963-82866985 ATAAGCAACCACAACAAATTAGG - Intergenic
1193571251 X:83147540-83147562 ATAAAAACTCTCAGCAAATTAGG - Intergenic
1195302705 X:103546693-103546715 ATAAAAACTCTCAGCAAATTAGG + Intergenic
1195462821 X:105146454-105146476 ATTAGCCATATAAGAAAATTTGG - Intronic
1196050385 X:111298060-111298082 AAAAGCCATCTCAGAAAGTTAGG + Exonic
1197303416 X:124809631-124809653 ATAAACAATTTCAACAAATTAGG + Intronic
1197485373 X:127043212-127043234 ATAAAAACTCTCAGCAAATTAGG + Intergenic
1198269219 X:135038707-135038729 ATAAAAAATCCCAGCAAATTGGG + Intergenic
1198807685 X:140506424-140506446 AGAAGCCATCCCGGCAGATTTGG + Intergenic
1201610093 Y:15831937-15831959 AAAAGAAATCACAGCAAATTGGG + Intergenic