ID: 966044548

View in Genome Browser
Species Human (GRCh38)
Location 3:175532677-175532699
Sequence GGTGGGTGTAGCCACCGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 10, 2: 37, 3: 82, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966044548_966044553 8 Left 966044548 3:175532677-175532699 CCATTACGGTGGCTACACCCACC 0: 1
1: 10
2: 37
3: 82
4: 221
Right 966044553 3:175532708-175532730 TACATATGAGTGTCGCCACCTGG 0: 1
1: 0
2: 0
3: 3
4: 37
966044548_966044555 23 Left 966044548 3:175532677-175532699 CCATTACGGTGGCTACACCCACC 0: 1
1: 10
2: 37
3: 82
4: 221
Right 966044555 3:175532723-175532745 CCACCTGGCTCCTGCCACTTTGG 0: 1
1: 0
2: 19
3: 121
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966044548 Original CRISPR GGTGGGTGTAGCCACCGTAA TGG (reversed) Intronic
902999200 1:20252744-20252766 GGTGGCTGAAGCCACAGAAATGG - Intergenic
903001837 1:20271940-20271962 GCTGGGTGTTGCCATGGTAATGG - Intergenic
905353838 1:37367045-37367067 GGTGGGCATAGCTACCATAATGG + Intergenic
906125649 1:43425551-43425573 TGTGGGTGGAGCCACAGTATGGG + Exonic
906879457 1:49574734-49574756 GGTGGGCATAGCTACCGTCATGG + Intronic
907780112 1:57559098-57559120 GCTGGGTTTAGCTACTGTAATGG + Intronic
908616471 1:65928455-65928477 GGTGGGCGTAGCTACCTTATTGG - Intronic
908737328 1:67290343-67290365 GGTGGATGTAGCTCCTGTAATGG + Intergenic
909032865 1:70562076-70562098 GGTGGGCATAGTTACCGTAATGG + Intergenic
909549186 1:76878906-76878928 GGTGGGCATAGCTACCTTAATGG - Intronic
909810775 1:79929822-79929844 GGTGGACGTAGCTACCATAATGG + Intergenic
910587980 1:88899996-88900018 GGTGGGTGTAGCTACTCTAATGG + Intergenic
910639201 1:89441703-89441725 GGTGGGTGTAGCTACCGTAATGG - Intergenic
910790190 1:91042698-91042720 GGAGGGCGTAGCTACCATAATGG + Intergenic
910966869 1:92816660-92816682 GGAGAGTGAAGCCACCGTGATGG - Intergenic
911109339 1:94165937-94165959 GGTGGGCGTAGTTACCATAACGG - Intronic
911980235 1:104557925-104557947 GGTGGGCATAGCTACCGTAGTGG + Intergenic
912050899 1:105526684-105526706 GGTGGGCATAGCTACCATAATGG - Intergenic
912944046 1:114069927-114069949 GGTGGGTGTAGCTACTGTAATGG - Intergenic
913039674 1:115010200-115010222 GGTGAGTGTAGCTACCACAATGG + Intergenic
916106568 1:161437030-161437052 GGTGGGTGTAGCTGCCGTAATGG - Intergenic
917217448 1:172692651-172692673 GGTGGGCGTAGCTACTGTGATGG - Intergenic
918171012 1:181997450-181997472 GGTGGGTGTAATAACCATAATGG - Intergenic
918774281 1:188609020-188609042 GGTGAGTGTAGCTACCAAAATGG + Intergenic
918918447 1:190673574-190673596 GGTGGGTGTAGCTACTGTAATGG - Intergenic
920133982 1:203754782-203754804 GGTGGGGGTTGCCACCATTAAGG + Intergenic
921619630 1:217311424-217311446 GGTGGGTGTAGGTACCATAATGG + Intergenic
923253803 1:232201122-232201144 GGTGGGTGTAGCTACAGTAATGG - Intergenic
1063978524 10:11435780-11435802 GGTGGGTGGAGCCCCCGTGGTGG + Intergenic
1066543498 10:36474728-36474750 GGTGGGTGTAGCTATCAAAAAGG + Intergenic
1066957572 10:42187664-42187686 GGTGAGCGTAGCTACGGTAATGG + Intergenic
1067754577 10:48995457-48995479 GGTGGGCATAGCTACCATAATGG - Intergenic
1068225578 10:54103340-54103362 GGTGGGTGTAGTTACCATAATGG - Intronic
1068446979 10:57136854-57136876 AGTGGGTGTAGCTACTGTAATGG + Intergenic
1069192551 10:65508107-65508129 GGTGGGCATAGCTACCATAATGG - Intergenic
1071937464 10:90547584-90547606 GGTGGGCATAGCTACCATAATGG + Intergenic
1071943012 10:90609518-90609540 GGTGGGTGTAGCTACTGTAATGG - Intergenic
1072360240 10:94652412-94652434 GGTGGGTGTAGTTACTGTAATGG + Intergenic
1072661011 10:97363544-97363566 GGTGGGGGCATCCACCGTAGGGG - Intronic
1072676568 10:97470753-97470775 GGTGGGTCTAGCCAAGGTTAGGG - Exonic
1073854869 10:107662481-107662503 AGGGGGTGTAGCTACTGTAATGG + Intergenic
1080976630 11:37350113-37350135 GGTGGGTGTAGCTACTGTAATGG + Intergenic
1081110240 11:39126667-39126689 GGTGGGCATAGCTACCATAATGG + Intergenic
1081608808 11:44546097-44546119 GGTGGGCATAGCTACTGTAATGG + Intergenic
1082999392 11:59277785-59277807 GGTGGGTGTAGCTACCATAATGG + Intergenic
1083623259 11:64059317-64059339 GATGCGTGTAGCCACCGACATGG + Intronic
1084623324 11:70288929-70288951 GCTGGGTGTGGCCACTGTCACGG + Intronic
1087382994 11:97431790-97431812 GGTGGGAGTAGCAACAGAAAGGG - Intergenic
1087410976 11:97789906-97789928 GATGGCTGTAGCTACCATAATGG - Intergenic
1088191908 11:107236257-107236279 GGTGGGCATAGCTACCATAATGG - Intergenic
1088407842 11:109500420-109500442 GGTGGGCAGAGCTACCGTAATGG - Intergenic
1090541603 11:127712177-127712199 GGTGGGTATGGCTACCATAATGG - Intergenic
1090778385 11:129984822-129984844 GATGGCTGTTGCCACCCTAAAGG - Intronic
1091051508 11:132376988-132377010 GGTGGGTGTAGCTACTGCAGTGG + Intergenic
1092093044 12:5819877-5819899 GGTGGGTGTACCTACTGTAATGG + Intronic
1093032092 12:14297711-14297733 GGCGGGTATAGCTACCATAAAGG - Intergenic
1093049155 12:14486712-14486734 GGTGGGCGTAGCTACCGTAATGG - Intronic
1094102302 12:26777506-26777528 GGTGGGTGTAACTACCATAATGG + Intronic
1095844701 12:46732242-46732264 GGTGGGTGTAGCTACTGTAATGG - Intergenic
1096457714 12:51801186-51801208 GGTGGGCGTAGCTACCATAATGG - Intronic
1098672813 12:73252494-73252516 GGAGGGTGTAGCTACTGTAATGG + Intergenic
1098730827 12:74035597-74035619 GGTGGGTGTAGCTACCGTAATGG + Intergenic
1098733083 12:74063887-74063909 GGTGGCCGTAGCTACCATAATGG + Intergenic
1099184024 12:79498428-79498450 GGTAGGCATAGCTACCGTAATGG - Intergenic
1099375416 12:81892210-81892232 GGTAGGCATAGCTACCGTAATGG + Intergenic
1100049990 12:90436176-90436198 GGTGGGCATAGCTACAGTAATGG + Intergenic
1100241397 12:92713446-92713468 GGTGGGTGTAGCTACCATAATGG - Intergenic
1101263889 12:103064352-103064374 GGTGGTTGTAGCTACTGTAATGG + Intergenic
1101534911 12:105607861-105607883 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1101542852 12:105680908-105680930 GGTGGGCGTAGCTACCATAAAGG + Intergenic
1103035339 12:117651979-117652001 GGTGAGAGTAGCTACTGTAATGG + Intronic
1103396284 12:120609693-120609715 GGTGGGTATAGTTACCATAATGG + Intergenic
1105788337 13:23771169-23771191 GGTGGGTGTGGCCACGGTCAGGG - Intronic
1105878615 13:24583416-24583438 GGTGGGTGTAGAAACCCTAAGGG + Intergenic
1109582829 13:64364384-64364406 GGTGGGCATAGCTACCATAATGG + Intergenic
1111016411 13:82387575-82387597 GGTGGACGTAGCTACCATAATGG - Intergenic
1111575981 13:90154516-90154538 TGTGGGTGTGGCTACCTTAATGG - Intergenic
1113963317 13:114138176-114138198 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963335 13:114138257-114138279 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963340 13:114138278-114138300 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963348 13:114138314-114138336 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963353 13:114138335-114138357 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963357 13:114138353-114138375 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963362 13:114138374-114138396 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963371 13:114138413-114138435 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963375 13:114138431-114138453 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963380 13:114138452-114138474 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963384 13:114138470-114138492 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963389 13:114138491-114138513 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963398 13:114138530-114138552 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963402 13:114138548-114138570 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963407 13:114138569-114138591 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963411 13:114138587-114138609 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963421 13:114138629-114138651 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963428 13:114138665-114138687 GGTGGGTGTAGACACAGTGGTGG + Intergenic
1113963433 13:114138686-114138708 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963442 13:114138725-114138747 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963452 13:114138767-114138789 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963465 13:114138824-114138846 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963480 13:114138887-114138909 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963493 13:114138947-114138969 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963496 13:114138965-114138987 GGTGGGTGTAGACACAGTGGTGG + Intergenic
1113963501 13:114138986-114139008 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963510 13:114139025-114139047 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963524 13:114139085-114139107 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963528 13:114139103-114139125 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963533 13:114139124-114139146 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963538 13:114139145-114139167 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963542 13:114139163-114139185 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963547 13:114139184-114139206 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963565 13:114139265-114139287 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963570 13:114139286-114139308 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963574 13:114139304-114139326 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963579 13:114139325-114139347 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963602 13:114139427-114139449 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963611 13:114139466-114139488 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963620 13:114139505-114139527 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963625 13:114139526-114139548 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963629 13:114139547-114139569 GGTGGGTGTAGACACAGTGGAGG + Intergenic
1113963644 13:114139628-114139650 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963662 13:114139703-114139725 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963667 13:114139724-114139746 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963672 13:114139745-114139767 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963676 13:114139763-114139785 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963681 13:114139784-114139806 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963688 13:114139820-114139842 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963693 13:114139841-114139863 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963696 13:114139859-114139881 GGTGGGTGTAGACACAGTGGCGG + Intergenic
1113963715 13:114139937-114139959 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1113963720 13:114139958-114139980 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963724 13:114139976-114139998 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963729 13:114139997-114140019 GGTGGGTGTAGACACGGTGGCGG + Intergenic
1113963737 13:114140039-114140061 GGTGGGTGTAGACACGGTGGTGG + Intergenic
1113963741 13:114140057-114140079 GGTGGGTGTAGACACGGTGGAGG + Intergenic
1114758499 14:25285613-25285635 GGTGGGCATAGCTACCGTAATGG - Intergenic
1115059480 14:29172144-29172166 GGTGGGTGTAGCTACCTTAATGG + Intergenic
1116058682 14:39895184-39895206 GGTGGGCATAGCCACCATAATGG + Intergenic
1116158614 14:41238431-41238453 GGTGGGTTTAGTGACTGTAATGG - Intergenic
1117001351 14:51374533-51374555 GGTGGGCATAGTTACCGTAATGG + Intergenic
1117216593 14:53558339-53558361 GGTGGGCATAGCTACCGTAATGG + Intergenic
1118880992 14:69825772-69825794 GGTGGGCATAGCTACCGTAATGG - Intergenic
1119468766 14:74880702-74880724 GGTGAGTGAAGGCACTGTAAAGG + Intergenic
1120556222 14:85932196-85932218 GGTGGGCATAGCTACTGTAATGG - Intergenic
1202935526 14_KI270725v1_random:84102-84124 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1126078124 15:44932773-44932795 GGTGGGTGTGGTCACCACAATGG + Intergenic
1127763933 15:62166331-62166353 GGTGGGTGAAGGCACCTGAAAGG - Intergenic
1141559785 16:84859793-84859815 GGTGGGCATAGCTACCGTAATGG - Intronic
1142433651 16:90043856-90043878 GGTGGGTGCAGCCAGCGTGCGGG + Exonic
1142945842 17:3426379-3426401 GTTGGCTGTAGCCACCATAATGG - Intergenic
1149236233 17:54594000-54594022 GGTGGGCATAGCTACCATAATGG - Intergenic
1153131513 18:1859480-1859502 AGTGAGTGTAGTTACCGTAATGG - Intergenic
1154068235 18:11129335-11129357 GGTAGGCGTAGCTACCATAATGG + Intronic
1154252974 18:12759354-12759376 GGTGGGCATAGCTACCATAATGG - Intergenic
1156192278 18:34733470-34733492 GGTGGGCATAGCTACCATAATGG - Intronic
1156537560 18:37878769-37878791 GGTGGGCATAGCTACCGTAATGG + Intergenic
1156998367 18:43495961-43495983 GGTGGGTGTATCTACTGTAATGG + Intergenic
1157054404 18:44209540-44209562 GGTGGATGTGGCTACTGTAATGG + Intergenic
1159287559 18:66373711-66373733 GGTGGGCATAGCTACCTTAATGG + Intergenic
1164097349 19:22023434-22023456 GGTGGGCATAGCTACTGTAATGG - Intergenic
1164117537 19:22236869-22236891 GGTGGGCATAGCTACTGTAATGG - Intergenic
1164200241 19:23012149-23012171 GGTGGGCATAGCTACTGTAATGG - Intergenic
1165077364 19:33287269-33287291 GGTGGATGGAGCCACAGAAAAGG - Intergenic
925460493 2:4058706-4058728 GGTGGGCATAGCTACTGTAATGG + Intergenic
926342116 2:11912183-11912205 GGTGGGTGTGGTTACTGTAATGG - Intergenic
930909926 2:56619103-56619125 GGTGGGCATAGCTACCATAATGG + Intergenic
933265943 2:80180481-80180503 GGTGGGCATAGTTACCGTAATGG - Intronic
934305686 2:91820178-91820200 GGTGGGCGTAGCTACCGTAATGG + Intergenic
934327570 2:92032564-92032586 GGTGGGCGTAGCTACCGTAATGG - Intergenic
934465957 2:94263143-94263165 GGTGGGTGTAGCTACCGTAATGG - Intergenic
936641013 2:114312940-114312962 AGTGGGTGTAGCTGCCATAATGG + Intergenic
937785423 2:125889475-125889497 GGTGGGCATAGCTACCATAATGG - Intergenic
937852792 2:126650474-126650496 GGTGGCCATAGCTACCGTAATGG - Intergenic
938375235 2:130800563-130800585 GGTGGGTGTGACTACCATAATGG + Intergenic
939068849 2:137516100-137516122 GGTGGGTGTAGCTGCCATAATGG + Intronic
940606144 2:155926116-155926138 GGTGGGTGTAGCTACTGTAATGG - Intergenic
943318073 2:186413413-186413435 GGTGGGCATAGCTACTGTAATGG - Intergenic
943384254 2:187182634-187182656 GGTGGGTGTAGCTACAGTAATGG - Intergenic
946528096 2:220541732-220541754 GGGGGGTGTAGCTACCGTAATGG - Intergenic
946790700 2:223297995-223298017 GGTGGGTGTAGTTACTGTAATGG + Intergenic
1169767945 20:9168984-9169006 GGTGGTTGTAGCAACCGCAAAGG - Intronic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1171062651 20:21981305-21981327 GGTGGGTGTGGCCAGCTTATGGG + Intergenic
1173709369 20:45141001-45141023 GGTGGGTGTAGCTACCATAATGG - Intergenic
1176596951 21:8706338-8706360 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1176942976 21:14946320-14946342 TGGTGGTGTAGCCAGCGTAATGG - Intergenic
1177002849 21:15635302-15635324 GGTGGGCGTAGCTACCATAATGG - Intergenic
1177933918 21:27318680-27318702 GGTGGGTGTAGCTACTGTAATGG - Intergenic
1178012407 21:28303162-28303184 GGTGGGCATAGCTACCGTAATGG + Intergenic
1178060969 21:28852906-28852928 GGTGGGTGTAGCTACCAGAATGG - Intergenic
1178764050 21:35432693-35432715 GGTGGGTGTAGCTACCGTAACGG - Intronic
1180279874 22:10683780-10683802 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1180587092 22:16902316-16902338 GGTGGGCATAGCTACCGTAATGG - Intergenic
1184603802 22:45560152-45560174 GGTGGGTGTAGCTTCTGTAATGG - Intronic
949170268 3:988337-988359 GGTAGGCATAGCTACCGTAATGG - Intergenic
949445384 3:4129285-4129307 AGTGGGTGTACCTACTGTAATGG + Intronic
949638556 3:6010771-6010793 GGTGGGCATAGCTACCGTAATGG + Intergenic
951384318 3:22025985-22026007 GGTGGGCATAGCTACCATAATGG + Intronic
951970985 3:28443622-28443644 GGTGGGCATAGCTACTGTAATGG - Intronic
953451882 3:43012816-43012838 GCTGTGTGTAGCCACAGGAAGGG + Intronic
953452314 3:43015293-43015315 GCTGTGTGAAGCCACTGTAAGGG + Intronic
953897623 3:46814257-46814279 GGTGGGCATAGCTACTGTAATGG - Intergenic
954053889 3:48005940-48005962 GGTGGGCGTAGCTACCGTAATGG + Intronic
954284288 3:49607860-49607882 GGTGGGTCCAGCCACCTGAAAGG + Intronic
956509412 3:69978594-69978616 GGTGGGTATAGCTACCATAATGG + Intergenic
957897890 3:86447069-86447091 GGTGGACATAGCTACCGTAATGG + Intergenic
959377620 3:105604924-105604946 GGTGAGTGTAGCTACCATAATGG - Intergenic
959746244 3:109779013-109779035 GGTGGGTGTAGCTACTGTAATGG - Intergenic
963630080 3:147721465-147721487 GGTGGGTGTAGCGACCGTAATGG + Intergenic
963661162 3:148130378-148130400 GGAGGGTGTAGTGACTGTAATGG + Intergenic
966044548 3:175532677-175532699 GGTGGGTGTAGCCACCGTAATGG - Intronic
966445453 3:179996802-179996824 GGTGGGCGTAGCTACTGTAATGG + Intronic
970089414 4:12388108-12388130 GGTAGGTGTAGCTACCATAATGG - Intergenic
971002905 4:22342085-22342107 GGTAGGCATAGCTACCGTAATGG + Intergenic
971979519 4:33734622-33734644 GTTGGGTATAGCTACCATAATGG - Intergenic
972048106 4:34694430-34694452 GGTGGGTGTAGTTACCATAATGG - Intergenic
972085013 4:35205270-35205292 GGTGGGAGTAGCTGCTGTAATGG + Intergenic
972095284 4:35340923-35340945 GGTGGGTGTAGCTACCCTAATGG + Intergenic
972883197 4:43449911-43449933 GGTGGGCATAGCTACCATAATGG - Intergenic
973102717 4:46293013-46293035 GGTGGGTGGAGCTACTGTAATGG + Intronic
974479244 4:62422617-62422639 GGTGGGTATAGTTACTGTAATGG - Intergenic
974564573 4:63566559-63566581 GGTGGGTGTAGTTACTGTAAAGG + Intergenic
974644841 4:64676534-64676556 GGTGGGTGTAGCTAACATAATGG - Intergenic
975982849 4:80179033-80179055 AGTGGGTATAGCTACCATAATGG - Intergenic
977833491 4:101619935-101619957 GGTGGGTGTATCTACTGTAATGG - Intronic
978899302 4:113928602-113928624 GGTGGGTGTAGCTCCCATAATGG - Intronic
979017941 4:115458652-115458674 GGTGGGCGTAGCTACCATAGTGG - Intergenic
979075493 4:116264641-116264663 GGTGGGTGTAGCTACCATAATGG + Intergenic
980388142 4:132112871-132112893 GGTGGATGTAGCTACCTTAATGG - Intergenic
980406120 4:132355561-132355583 GGTAGGTGTAGCTATCATAATGG - Intergenic
980497762 4:133607136-133607158 GGTGGGCATAGCTACCGTAATGG - Intergenic
980629317 4:135412508-135412530 GGTGGGAGGAGCTACCATAATGG + Intergenic
982847545 4:160272544-160272566 GGTGAGTGTAACTACCATAATGG + Intergenic
983184829 4:164689806-164689828 GGTGGGCATAACTACCGTAATGG + Intergenic
986037267 5:3952202-3952224 GGTGGGTGTAGCTGCCATCATGG - Intergenic
986938548 5:12920499-12920521 GTTGGGTGTAGCTATTGTAATGG - Intergenic
986959604 5:13197441-13197463 GGTGGGCATAGCTACCTTAATGG + Intergenic
987152944 5:15059906-15059928 GGTGGGTGTAGCGACCGTAATGG + Intergenic
987578585 5:19760097-19760119 GGTGGGTGTAGCTACCATAATGG - Intronic
987595212 5:19988644-19988666 AGTGGGAGTAGCCACCGGGAGGG + Intronic
987621598 5:20343150-20343172 GGTGGGCGTAGCTACCATAATGG + Intronic
988107540 5:26770758-26770780 AGTGTGTGTGGCTACCGTAATGG + Intergenic
988161035 5:27518637-27518659 GGTGGGTACAGCTACAGTAATGG - Intergenic
988169414 5:27634577-27634599 GGTGGGCGTAGATACTGTAATGG - Intergenic
988188559 5:27899486-27899508 GGTGGGCATAGCTACTGTAATGG + Intergenic
989045498 5:37269674-37269696 GGTGGGCATAGCTACCATAATGG - Intergenic
989097601 5:37795574-37795596 GGTGGGCATAGCTACCATAATGG + Intergenic
991014049 5:61912671-61912693 GGTGGTCGTAGCTACTGTAATGG - Intergenic
993232127 5:85249304-85249326 GGTGGGCATAGCTACCATAATGG - Intergenic
993319604 5:86456832-86456854 GGTGAGTGTAGCTACTGTAATGG + Intergenic
993791565 5:92217157-92217179 GGTGGGTATAGCTACCGTAATGG + Intergenic
994984647 5:106917484-106917506 GGTGGGCATAGCTACTGTAATGG - Intergenic
995156003 5:108913994-108914016 GGTGGGTGTAGTGACTGAAAGGG + Intronic
995776522 5:115729439-115729461 GGTGGGAGTAGCTACCATAATGG - Intergenic
996825329 5:127676065-127676087 GGTGGGAGTAGCTACCATAATGG + Intergenic
998290561 5:140910351-140910373 GGTGGGCATAGCTACCATAATGG - Intronic
999351159 5:150873091-150873113 GGTGGGCATAGCTACCATAATGG + Intronic
1002613802 5:180437869-180437891 GGTGGGTGTAAACACAGGAAAGG - Intergenic
1002626602 5:180533995-180534017 GATGGGTGTGGCCACCTTTATGG - Intronic
1003758381 6:9148319-9148341 GGTGGGTGTAACTACCGTAATGG + Intergenic
1006001271 6:30967002-30967024 TGTGGGTGTAGGTACCATAATGG + Intergenic
1006062114 6:31431396-31431418 GGTGAGTGTAGCTACCATAATGG + Intergenic
1009787210 6:68355252-68355274 GGCTGGTGTAGCTACTGTAATGG - Intergenic
1009806266 6:68605188-68605210 GGTGGTTGTAGCTACCATAATGG + Intergenic
1010108227 6:72192681-72192703 GGTGGGCATAGCTACCATAATGG - Intronic
1010325555 6:74558359-74558381 GGTGGGCATAGCTACCATAAAGG - Intergenic
1010580956 6:77595503-77595525 GGTGGGCCTAGCTACCTTAATGG - Intergenic
1012344356 6:98168571-98168593 GGTGGGCGTAGCTACCATAATGG + Intergenic
1012820569 6:104081162-104081184 GGTGGGCATAGCTACCATAATGG + Intergenic
1014416774 6:121193616-121193638 GGTGGGCCTAGCTACCGTAATGG + Intronic
1014534432 6:122598386-122598408 GGTGGGTGTAGCTACTGTAATGG - Intronic
1014970030 6:127802449-127802471 GGTGGGCGTAGCTACCATAATGG + Intronic
1015475504 6:133655558-133655580 GGTAGGCGTAACTACCGTAATGG + Intergenic
1016419838 6:143872440-143872462 GGTGGATGTAGCTACTGTAATGG - Intronic
1016576478 6:145574357-145574379 GGTGGGTGTAGCTACCATAATGG - Intronic
1017228054 6:152042851-152042873 GGTGGGTGCAATTACCGTAAAGG - Intronic
1017977345 6:159369826-159369848 GGTGGGCATAGCTACCATAATGG - Intergenic
1018569728 6:165196307-165196329 GGTGGGCATAACTACCGTAATGG + Intergenic
1019040566 6:169100692-169100714 GGTGGGTGTAGCTACTATAATGG + Intergenic
1024040114 7:45546463-45546485 GGTAGGCATAGCTACCGTAACGG - Intergenic
1025156115 7:56607038-56607060 GGTGGGTGTAGTTACCATAATGG - Intergenic
1025761944 7:64403744-64403766 GGTGGGTGTAGTTACCATAATGG + Intergenic
1027406987 7:77872517-77872539 GGTGGGTGTGGCTACCATAATGG - Intronic
1028141516 7:87280214-87280236 GGTGGGGATAGCTACCATAATGG + Intergenic
1028237593 7:88381085-88381107 GGTGGGCGTAGCTACCATAATGG + Intergenic
1029257562 7:99279801-99279823 ACTGGGTGTAGCCACCATAGGGG - Intergenic
1030277228 7:107734342-107734364 GGTGGGTATAGCTACTGTAATGG + Intergenic
1030457679 7:109794803-109794825 GGTGGGAGTAGCTACTGTAATGG - Intergenic
1031236618 7:119186247-119186269 GGTGGGTGTAGTTACTGTAATGG + Intergenic
1031676330 7:124616578-124616600 GGTGGGCGTAGCTACTATAATGG + Intergenic
1031779351 7:125942005-125942027 GGTGGACGTAGCTACCGTAATGG - Intergenic
1033075978 7:138250942-138250964 GGTGGGCGTAGCTACCATAATGG + Intergenic
1038880507 8:31605680-31605702 GATGGGAGGGGCCACCGTAAAGG + Intergenic
1040916372 8:52569600-52569622 GGTGGGCGTAGCTACCATAATGG - Intergenic
1041803221 8:61822481-61822503 GGTGGGTGTGGCTACTGTAAAGG - Intergenic
1041934251 8:63319104-63319126 GGTGGGCGTAGCTACCGTAGTGG + Intergenic
1042001286 8:64125730-64125752 GGTGGGCATAGCTACCATAATGG - Intergenic
1043257777 8:78157600-78157622 GGTGGGCATAGCTACCGTAATGG + Intergenic
1044133533 8:88556915-88556937 GGTGGCTGTGGTTACCGTAATGG + Intergenic
1044150569 8:88771302-88771324 GTTGGGTGTAGCTACCGTAATGG + Intergenic
1044202170 8:89450726-89450748 GGTGGGTGTAGCAAGCATACTGG + Intergenic
1045221539 8:100204918-100204940 GGTGGACGTAGCTACCATAATGG + Intronic
1046128899 8:109943367-109943389 GGTTGGTGTGGCTACTGTAATGG - Intergenic
1046586007 8:116149401-116149423 GATGGGTGTAGCTACTGTAATGG - Intergenic
1046965307 8:120158121-120158143 TGTGGGTGGAGCCACTGAAAAGG - Exonic
1049450774 8:142660296-142660318 GGTGGGTGTGGCAGCCGTGAGGG - Intronic
1049804098 8:144531128-144531150 CGTCTGTGTAGCCACCGTGAGGG + Intronic
1050447278 9:5738893-5738915 GGTGGGCGTAGCTACTGTAATGG - Intronic
1050482435 9:6100847-6100869 GTTGGGTGTAGCTACCATAATGG + Intergenic
1051881906 9:21848892-21848914 GGTGGGCATAGCTACCATAATGG + Intronic
1051966184 9:22832474-22832496 GGTGGGTGTAGCTACTGTAATGG + Intergenic
1052227376 9:26106603-26106625 GGTGGGTGTAGCTACCATAATGG + Intronic
1053696012 9:40639920-40639942 GGTGGGCATAGCTACCGTAATGG - Intergenic
1054307259 9:63439138-63439160 GGTGGGCATAGCTACCGTAATGG - Intergenic
1054405990 9:64763130-64763152 GGTGGGCGTAGCTACCGTAATGG - Intergenic
1054439616 9:65248617-65248639 GGTGGGCGTAGCTACCGTAATGG - Intergenic
1054490791 9:65773322-65773344 GGTGGGCGTAGCTACCGTAATGG + Intergenic
1056314468 9:85374713-85374735 GGTGGGCATAGCTACTGTAATGG - Intergenic
1057316692 9:93973665-93973687 GGTGGGCATAGCTACTGTAATGG + Intergenic
1058239636 9:102540765-102540787 GGTGGGTATAGTTACAGTAATGG + Intergenic
1202778459 9_KI270717v1_random:13533-13555 GGTGGGCATAGCTACCGTAATGG - Intergenic
1186470010 X:9813848-9813870 GGTGTGCGTAGCTACCATAATGG - Intronic
1191659040 X:63631749-63631771 GGTGGGCATAGCTACCATAACGG - Intergenic
1191719475 X:64217421-64217443 GATGGGTGTAGTTACCATAATGG - Intergenic
1192661788 X:73049525-73049547 GGTGGGTGTAGCTTCCATAATGG - Intergenic
1193433128 X:81437183-81437205 GGTGGGCATAGCTACCGTAATGG - Intergenic
1193446939 X:81617025-81617047 GGTGGGCATAGCTACCATAATGG + Intergenic
1193573910 X:83176738-83176760 GGTGGGTATAGCTACCGTAATGG - Intergenic
1193904376 X:87224797-87224819 GGTGGGCATAGCTACTGTAATGG + Intergenic
1194032222 X:88831623-88831645 GGTGGGTGTAACTACCATAATGG - Intergenic
1194210053 X:91060598-91060620 GGTGGGCGTAGCTACCACAATGG + Intergenic
1194443339 X:93959334-93959356 GGTGGGCATAGCTACCATAATGG + Intergenic
1194833715 X:98657030-98657052 GGTGGACATAGCTACCGTAATGG + Intergenic
1195749076 X:108146442-108146464 GGTGGGCATAGCTACCGTAATGG - Intronic
1195782596 X:108481635-108481657 GGTGGGTGTACCTACCGTAATGG - Intronic
1196372562 X:114995868-114995890 GGTTGGTGTAGCTACCTTAATGG - Intergenic
1197002062 X:121451186-121451208 GGTGGGCATAGCTACCATAATGG + Intergenic
1197245337 X:124161076-124161098 GGTGGGTGTAGCTACTGTAATGG - Intronic
1197409449 X:126097598-126097620 GGTGGGCATAGCTACTGTAATGG - Intergenic
1197425974 X:126297376-126297398 GGTGGGCATAGCTACCATAATGG - Intergenic
1197591632 X:128417576-128417598 GGTGGGCATAGCTACCATAATGG + Intergenic
1198701059 X:139398523-139398545 GGTGGCCATAGCAACCGTAATGG + Intergenic
1198783269 X:140259567-140259589 GGTGGGCATAGCTACTGTAATGG - Intergenic
1198933783 X:141886086-141886108 GGCGGGTATAGCTACCATAATGG + Intronic
1199446931 X:147935510-147935532 GGTGGATGTGGCCAATGTAAGGG + Intronic
1200521066 Y:4210277-4210299 GGTGGGTGTAGCTACCATAATGG + Intergenic
1201193771 Y:11471832-11471854 GGTGGGCGTAGCTACTGTAATGG - Intergenic
1201529855 Y:14979748-14979770 GGTGGGTGAAGCTTCTGTAATGG - Intergenic
1201798233 Y:17924937-17924959 GGTGGGTGTAGGTACCATAATGG + Intergenic
1201803320 Y:17981020-17981042 GGTGGGTGTAGGTACCATAATGG - Intergenic
1202359557 Y:24093628-24093650 GGTGGGTGTAGGTACCATAATGG + Intergenic
1202511221 Y:25576486-25576508 GGTGGGTGTAGGTACCATAATGG - Intergenic