ID: 966046395

View in Genome Browser
Species Human (GRCh38)
Location 3:175556024-175556046
Sequence CTCTGGAGTCTGCTGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966046395_966046400 -3 Left 966046395 3:175556024-175556046 CCAGAGAACAGCAGACTCCAGAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 966046400 3:175556044-175556066 GAGCTAAGGGCATCGTCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 75
966046395_966046399 -4 Left 966046395 3:175556024-175556046 CCAGAGAACAGCAGACTCCAGAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 966046399 3:175556043-175556065 AGAGCTAAGGGCATCGTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 85
966046395_966046402 30 Left 966046395 3:175556024-175556046 CCAGAGAACAGCAGACTCCAGAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 966046402 3:175556077-175556099 CTCACTTCAGCATTTATTAATGG 0: 1
1: 0
2: 2
3: 39
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966046395 Original CRISPR CTCTGGAGTCTGCTGTTCTC TGG (reversed) Intronic
900646413 1:3710687-3710709 GTCTGGAGGCTGCGGTTCACAGG + Intronic
901817145 1:11800774-11800796 CTCTGGTGCCCGCTGTTGTCAGG - Intronic
901870190 1:12134283-12134305 ATCTGGAATATGCTGTTGTCAGG - Intronic
902200835 1:14832294-14832316 CTCTGGGATCTGCTGTGCTGTGG + Intronic
902529308 1:17080327-17080349 CTGTGGCTTCTGCTGTTCACTGG - Intronic
902572334 1:17354733-17354755 CTCTGGCCTCTGCTTTTCTACGG - Intronic
902594991 1:17503274-17503296 CTCAGGAGTCTGCTGTCAGCTGG - Intergenic
904422658 1:30404265-30404287 CCCTAGAGTCTGCAGTTCCCTGG - Intergenic
904478383 1:30778808-30778830 CTCTGGGCTCTGCTCATCTCTGG - Intergenic
904945394 1:34195421-34195443 GTCTGGAGTCTGCTTTTTGCAGG + Intronic
905270075 1:36781989-36782011 CTCTGGAGCTTGGTGTCCTCAGG - Intergenic
911154099 1:94622548-94622570 CACCAGAGTCTGCTTTTCTCAGG + Intergenic
912167146 1:107055626-107055648 CTCTTGAGTCTGCACTTTTCAGG + Intergenic
913956481 1:143302056-143302078 CAGTGGATTATGCTGTTCTCAGG - Intergenic
913980960 1:143513611-143513633 CAGTGGATTATGCTGTTCTCAGG + Intergenic
914075324 1:144340039-144340061 CAGTGGATTATGCTGTTCTCAGG + Intergenic
914103854 1:144626457-144626479 CAGTGGATTATGCTGTTCTCAGG - Intergenic
917176143 1:172237890-172237912 CTTTGGAGACTGGCGTTCTCAGG + Intronic
918001907 1:180505399-180505421 ATCAGGAGCCTGCTGTTCCCTGG - Intergenic
918260267 1:182789599-182789621 CACTGGAGTCTGCTCTTCCCCGG - Intronic
921241059 1:213183341-213183363 ATGTGTAGTCTGCTGTTCTTAGG - Intronic
922196868 1:223366248-223366270 CCCTTGAGTCTTCTCTTCTCTGG + Intergenic
922779336 1:228239559-228239581 CTCTGCAGCCAGATGTTCTCAGG - Intronic
924096554 1:240557494-240557516 CTCTGTAGTCTTCTGCTTTCAGG - Intronic
1064086494 10:12349616-12349638 CTCTTATTTCTGCTGTTCTCGGG - Exonic
1065131507 10:22625505-22625527 ATCTGGAGTCTATTGTTCTAAGG + Intronic
1066781692 10:38955205-38955227 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1068980326 10:63056114-63056136 CCCTGGAGTCTGATGTTCCAGGG - Intergenic
1069108328 10:64410980-64411002 ATCTGGAGTCTGATGTTCAAGGG + Intergenic
1069181032 10:65358665-65358687 CTTTGGTGTCTGCTGTTTGCTGG - Intergenic
1069518694 10:69100713-69100735 CCCTGGCGTCTGCATTTCTCAGG + Intronic
1070571885 10:77646246-77646268 GTCAGGAGACTGCTGTTCCCTGG + Intergenic
1073132106 10:101196260-101196282 CTCTGGAGGCTCCTCTTCTGTGG - Intergenic
1074393876 10:113080817-113080839 CTCTGGAGTTTGATGTTGTCAGG + Intronic
1074755000 10:116617945-116617967 CTTTAGAGTGTGGTGTTCTCTGG - Intergenic
1074841890 10:117361370-117361392 CTCTGCAGTGTGTTGCTCTCTGG + Intronic
1074961666 10:118451356-118451378 CTGTGGATTCTCCTGTTCTCAGG - Intergenic
1075546175 10:123356552-123356574 CTCTGAATGCTGCTCTTCTCAGG + Intergenic
1075623253 10:123943515-123943537 CTCTGCAGCCTGCTGGTCCCTGG - Intergenic
1076212494 10:128659588-128659610 CTCTGCACTCTGCTGTCTTCTGG + Intergenic
1076418376 10:130309054-130309076 ACCTGGAGCCTGCTGTTTTCAGG + Intergenic
1076860065 10:133136137-133136159 CTGTGGAGGCGGCTGGTCTCTGG + Intergenic
1076860359 10:133136943-133136965 CTGTGGAGGCGGCTGGTCTCTGG + Intergenic
1076860493 10:133137322-133137344 CTGTGGAGGCGGCTGGTCTCTGG + Intergenic
1077006509 11:360409-360431 CTCTGGACTCCCCTGTTATCAGG + Intergenic
1077115777 11:884023-884045 CTGTGGAGTTTGCTGTGCCCAGG + Intronic
1077354654 11:2109537-2109559 CTGTGGGGCCTGCTGTTCTGAGG - Intergenic
1077720087 11:4619536-4619558 GTCTTGCTTCTGCTGTTCTCCGG - Intergenic
1079647264 11:22881076-22881098 CTCTGGAGTCTTATTTTGTCAGG + Intergenic
1080100905 11:28458111-28458133 CTCTCCAGTCTGATATTCTCTGG + Intergenic
1080200933 11:29668938-29668960 CCCTGGAGTCTGCATTTCTGTGG - Intergenic
1080745561 11:35105549-35105571 CTCTGGTGTGTGTTGCTCTCTGG - Intergenic
1080800107 11:35602534-35602556 CTCTAGAGACTTCTCTTCTCTGG + Intergenic
1083247310 11:61439193-61439215 CTCTGGAGTGTGCCTTCCTCTGG - Intronic
1083744187 11:64726167-64726189 GTCTGGAGTCTCCTGATCCCAGG + Intergenic
1084502444 11:69542853-69542875 CTCTGCAGTCTGCACTCCTCGGG + Intergenic
1084581102 11:70024054-70024076 CTCTTGGCTCTGCTGTTCTTTGG + Intergenic
1084743324 11:71152847-71152869 ATCAGGTGTCTGCTGTTCCCAGG - Intronic
1084967456 11:72752050-72752072 CTCTGGAGTCAGCCGCCCTCGGG - Intronic
1085677093 11:78532967-78532989 CTCTGGAGTCTTGTTTTTTCTGG + Intronic
1088506368 11:110531655-110531677 CTCTGGAGTCCGCTGTCAGCTGG + Intergenic
1089315544 11:117588640-117588662 CTCTCGAGTGTGCTGTCATCAGG + Intronic
1089366088 11:117921895-117921917 CTCTGGATGCTGCTCTCCTCTGG - Intronic
1089711733 11:120319783-120319805 CTCTAGAGTCTGCTTTTTTGTGG + Exonic
1089870483 11:121668403-121668425 CTCTGGAGTCAGATGGCCTCAGG - Intergenic
1090190715 11:124765192-124765214 CTCTTGAGTTTGCTCTTCTTTGG - Intergenic
1094051479 12:26225891-26225913 CTTTTGACTCTGCTGTTTTCTGG - Intronic
1094590549 12:31815527-31815549 GGCTGGAGTTTGCTGATCTCTGG - Intergenic
1094753886 12:33443660-33443682 CTCAGGTGTCTGCTGATCCCTGG + Intergenic
1095840293 12:46685014-46685036 CTCTGGTCCCTGCTGTTCCCAGG - Intergenic
1099150021 12:79098866-79098888 CTGTGTAGTGTGCTGTTCACAGG - Intronic
1101252942 12:102953055-102953077 CTGGGGTGTCTGCTGTTCTAAGG - Intronic
1101286780 12:103322221-103322243 CTCTAGAGTCTTCCCTTCTCTGG + Intronic
1101500281 12:105298029-105298051 GTCTGGAGACTGGTGGTCTCAGG + Intronic
1101633931 12:106521636-106521658 CTCTGGACTCTGCTGTTTTCTGG - Intronic
1102733497 12:115136106-115136128 CACTGGAAGCTGCTGTTGTCTGG + Intergenic
1104412650 12:128572244-128572266 CTGTGGTCTCTGCTGGTCTCTGG + Intronic
1104531868 12:129579586-129579608 CCCTGGAGTCTGATGTTCGAGGG + Intronic
1104564087 12:129864612-129864634 CTCTTGTCTCTGCTGTCCTCGGG - Intronic
1104607447 12:130200311-130200333 CTCTGGGAGCTGCTGCTCTCAGG + Intergenic
1106219221 13:27731251-27731273 CACTGGATTCTGCCTTTCTCGGG - Intergenic
1107570911 13:41657236-41657258 CTCTTGGCTCTGCTTTTCTCGGG - Intronic
1109459605 13:62638648-62638670 TTCTGGAGGATGCTGTACTCAGG - Intergenic
1110678354 13:78277520-78277542 CTCTGGAGTATGCTCCTATCAGG + Intergenic
1111814447 13:93133111-93133133 CTCTGAAATTTGCTGTTATCTGG + Intergenic
1113136356 13:107094343-107094365 CTCAGGACTCTGCTGTTAGCTGG + Intergenic
1113913573 13:113856480-113856502 CTCCTGAGAGTGCTGTTCTCGGG - Intronic
1115405089 14:33006093-33006115 CTCTGGAGCCTACTTGTCTCTGG + Intronic
1116387525 14:44349432-44349454 CTTAGGAGTTTGCTGTTCTCTGG - Intergenic
1116866881 14:50038485-50038507 GGATGGAGTCTTCTGTTCTCTGG + Intergenic
1117343277 14:54809416-54809438 CCCAGGAATCTGCTTTTCTCAGG + Intergenic
1119330195 14:73787484-73787506 CGCTGGAGTCCCCTGCTCTCAGG + Intronic
1119360135 14:74042323-74042345 CTCAGGAATAGGCTGTTCTCAGG + Intronic
1119406076 14:74400559-74400581 CTCTGGTCCCTGCTGGTCTCTGG - Intergenic
1121227813 14:92334274-92334296 CTCCGGAGGCTGCCCTTCTCAGG - Intronic
1121257683 14:92543191-92543213 CCCTAGAGTCTTCTGTTTTCCGG - Intronic
1121665527 14:95669169-95669191 CTCTTGTCTCTGGTGTTCTCTGG + Intergenic
1121672791 14:95725735-95725757 CTCTGGGGTCTGCTGGTGCCTGG + Intergenic
1121774867 14:96584018-96584040 CTGTGGCGACTGGTGTTCTCTGG + Intergenic
1121779701 14:96614372-96614394 CTCTGGTGTATGCTGCCCTCAGG - Intergenic
1121944186 14:98103413-98103435 CTCTGCAGCCAGCTGATCTCTGG + Intergenic
1122408637 14:101514769-101514791 CTGTGGAGTCTGGTGTTTACTGG - Intergenic
1123029524 14:105445126-105445148 CTTGGGACCCTGCTGTTCTCAGG + Intronic
1123168295 14:106347485-106347507 CTCAGGCGCCTGCTGATCTCAGG - Intergenic
1202938896 14_KI270725v1_random:123732-123754 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1123394242 15:19912545-19912567 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1125360344 15:38858053-38858075 CTCTGGAGCCACCTGTTGTCAGG + Intergenic
1126768625 15:52033468-52033490 ATCTGGAGTCTGATGTTCAAGGG - Intronic
1128818317 15:70630130-70630152 CTCTGCAGGGTGCTGTGCTCTGG - Intergenic
1129373107 15:75110146-75110168 CTATGGGATCTGCTGTTCTTTGG + Intronic
1129711675 15:77823553-77823575 CTCTGGAGTCCCCACTTCTCTGG - Intergenic
1130671746 15:85918989-85919011 TTCTGTGGTGTGCTGTTCTCTGG + Intergenic
1133837288 16:9378388-9378410 CACTGGGGTTGGCTGTTCTCAGG - Intergenic
1134375294 16:13666600-13666622 CTCTGGAGTGGGCAGTTCACTGG + Intergenic
1135560126 16:23469750-23469772 CTCTTGACTCTGCTTTTCTTTGG - Intronic
1135849889 16:25953657-25953679 CTCTAGAGTCTGCTCTTCAGAGG - Intronic
1136346482 16:29679305-29679327 CTCTGGAGTCATCTCTCCTCTGG + Intronic
1136700262 16:32130434-32130456 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1136767388 16:32797030-32797052 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1136800760 16:33073671-33073693 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1136863648 16:33722196-33722218 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1136868892 16:33783595-33783617 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1137085519 16:36117331-36117353 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1138087233 16:54144072-54144094 CTCTGGGGCATGCTGTTCTCAGG - Intergenic
1138437573 16:57012747-57012769 GTCTGGGGACTGCTGTTCTAAGG + Intronic
1139479356 16:67220589-67220611 CTCTGTGGCCTGCTGTTCTGTGG + Intronic
1140046447 16:71442931-71442953 TTCTGGAGTCTCCTGTGCTCAGG + Intergenic
1140139383 16:72240694-72240716 GCCTGGCATCTGCTGTTCTCCGG + Intergenic
1141016162 16:80452075-80452097 CTCTGCAGTTTACTGTACTCTGG - Intergenic
1141434068 16:83989175-83989197 GTCTGGAGTCTGTTGATCACTGG + Intronic
1141467452 16:84215633-84215655 CTCTGTAGTCTCCTGTAATCTGG - Intergenic
1141945798 16:87309057-87309079 ATCTGGAAACTGCTGTTCTGTGG + Intronic
1142273653 16:89104409-89104431 CACTGGTGGCTGCTGTGCTCTGG - Intronic
1142412762 16:89924578-89924600 CTCCGGAGGCTGCCTTTCTCTGG - Intronic
1203069782 16_KI270728v1_random:1059052-1059074 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1203103282 16_KI270728v1_random:1332473-1332495 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1203125133 16_KI270728v1_random:1570342-1570364 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1145314291 17:21720068-21720090 CTCTGCCCTCTGCTGTGCTCGGG - Intergenic
1145326121 17:21827368-21827390 CAGTGGATTATGCTGTTCTCGGG + Intergenic
1145689176 17:26716852-26716874 CAGTGGATTTTGCTGTTCTCAGG + Intergenic
1145710951 17:26975643-26975665 CAGTGGATTATGCTGTTCTCGGG + Intergenic
1145712738 17:26992047-26992069 CTCTGCCCTCTGCTGTGCTCGGG - Intergenic
1147794922 17:43035444-43035466 CTCTGTGGTCTCCTGTTCCCGGG - Intergenic
1147979612 17:44266447-44266469 CTCTGGATTCTGCAGCTCTGAGG - Intronic
1149192297 17:54077573-54077595 CTATGGAATTTGCTGATCTCTGG + Intergenic
1149642469 17:58212589-58212611 CCCTGGAGTCAGCTGGTCTGGGG + Intronic
1150363159 17:64556170-64556192 CTGTGTAATATGCTGTTCTCTGG - Intronic
1151437325 17:74105944-74105966 CTCTGGGGGCTGCTGTTGTGGGG - Intergenic
1151670057 17:75567125-75567147 CTCTGGGGTCTGCTGCCCGCTGG - Intronic
1152283615 17:79399767-79399789 CTGTGGTGTCTGCTGCTCCCCGG - Intronic
1152562592 17:81086025-81086047 CTCTGGCCTCTGCAGTTCCCTGG + Intronic
1152685470 17:81691651-81691673 CTCTGGGGTCTGCAGGCCTCAGG - Intronic
1203190311 17_KI270729v1_random:178001-178023 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1153844664 18:9038449-9038471 GACTGGAATCTCCTGTTCTCAGG + Intergenic
1154164154 18:12001679-12001701 CTCTGGAGTCTGGCGGTCCCTGG - Intronic
1154516880 18:15179814-15179836 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG + Intronic
1157478696 18:48039269-48039291 CTCTGCAGTCTACTGGTCACCGG + Intronic
1159370459 18:67521467-67521489 CTCTGGAGGCTGCAGCTTTCAGG - Intergenic
1160537036 18:79600239-79600261 CTCTGGAGTCTCCTGTTCTGTGG + Intergenic
1161443571 19:4305452-4305474 CTCTGGGGTTTTCTGTCCTCAGG + Intronic
1163560283 19:18015168-18015190 CTCTTGAGGCTGCTGTGATCGGG - Intergenic
1165370340 19:35401701-35401723 CTCTGGGGACTGCGATTCTCTGG - Intergenic
1165675152 19:37716346-37716368 GACTGGAGTCTCCTGTTTTCAGG + Intronic
1166270021 19:41708035-41708057 CTCTGGGCTCTGCTGTCCTTGGG - Intronic
1166782705 19:45350776-45350798 CTGTGGATTCTGCTGATGTCAGG - Exonic
1202668551 1_KI270709v1_random:24421-24443 CAGTGGATTATGCTGTTCTCAGG + Intergenic
926616357 2:15000589-15000611 CTGTGGACTCAGCTGCTCTCAGG + Intergenic
927148125 2:20180185-20180207 GTCTGGAGTCTGATGCTCTGTGG - Intergenic
927576783 2:24207464-24207486 CTCTGGAGGGTGCTGTTCAGAGG + Intronic
928549687 2:32357961-32357983 GCCGGCAGTCTGCTGTTCTCAGG + Intronic
929177894 2:39000505-39000527 CTCTGGAGGCAGCTCTTCTAGGG + Intronic
931207837 2:60165097-60165119 CCCTGGAGGTCGCTGTTCTCCGG - Intergenic
931505619 2:62923085-62923107 CTCTGAAGTGTGCCCTTCTCTGG + Intronic
931703722 2:64929058-64929080 CATTGGAGGCTGCTGTTCTTTGG + Intergenic
933290174 2:80429418-80429440 CTCTGGAGTCTGGGATACTCGGG - Intronic
934252752 2:90375475-90375497 CAGTGGATTATGCTGTTCTCAGG - Intergenic
934256688 2:91427472-91427494 CAGTGGATTATGCTGTTCTCAGG + Intergenic
934716721 2:96549060-96549082 CTCTGGAGCCAGCTGCTCTGGGG + Intronic
937378234 2:121352510-121352532 CTCTGGAGGCTGCCTTTGTCGGG - Intronic
938517204 2:132024784-132024806 CAGTGGATTATGCTGTTCTCAGG - Intergenic
938721866 2:134074680-134074702 CTCTGGAAGCTGCTGATCTGAGG - Intergenic
939436907 2:142188799-142188821 GACTGGAATCTGCTGTTCTCAGG - Intergenic
941325700 2:164111345-164111367 CGCTGGAGACTGCTGTTTTAAGG - Intergenic
942059315 2:172213545-172213567 CTCTGCAGTGTATTGTTCTCGGG + Intergenic
942530988 2:176910215-176910237 CTCTGAAGTCTGACATTCTCTGG + Intergenic
943167487 2:184348757-184348779 TTCTTGAGTATTCTGTTCTCAGG + Intergenic
943349283 2:186778849-186778871 CTCTGGAGTGTGCCTTCCTCTGG + Intergenic
946178921 2:217938336-217938358 CTCTGGGGTCTCCTGTTTTCCGG - Intronic
946500291 2:220240024-220240046 CTCTGGCCTCTGCTGGGCTCTGG + Intergenic
946607098 2:221417207-221417229 CTCTGAAGCCAGCTGTTCTTAGG + Intergenic
947530740 2:230907268-230907290 ATCTGGGGCCTGCTCTTCTCCGG + Intergenic
947826619 2:233109958-233109980 CACTGCAGTCTGCATTTCTCAGG + Intronic
948054760 2:235002894-235002916 CCCTGGAATCTGCTGCTGTCAGG - Intronic
948234058 2:236374113-236374135 TTTTGGGGTCTCCTGTTCTCAGG + Intronic
948445991 2:238033205-238033227 TGCTGAAGTTTGCTGTTCTCAGG + Intronic
948460066 2:238124957-238124979 CTCTGGAGGCAGCTGAGCTCTGG - Intronic
948660775 2:239505348-239505370 CTGTGGGGTGTCCTGTTCTCCGG + Intergenic
948915911 2:241035025-241035047 CTCTGGAGACTGCGGGTTTCGGG + Intronic
948920307 2:241063269-241063291 CCCTGGAGCCTGCGTTTCTCAGG - Intronic
948976435 2:241466454-241466476 CTGAGGAGTCTGCTGGTCCCCGG - Intronic
1169555611 20:6746058-6746080 CTCTGGAAACTGCATTTCTCAGG - Intergenic
1170831864 20:19849842-19849864 TTCTGGAGGCTGCTGTTTTGAGG - Intergenic
1171794064 20:29552811-29552833 TTCTGGAGACTGCTGATCTTGGG + Intergenic
1172230040 20:33330420-33330442 TTCTGGGGTCTGGAGTTCTCGGG - Intergenic
1172360073 20:34306237-34306259 CTTTGGAGACTGCTGGTCTCAGG + Intronic
1175397335 20:58675386-58675408 CTCTGAACTCTGCTGTCCTCTGG + Intronic
1175499335 20:59438809-59438831 CCCTGGCGACTCCTGTTCTCAGG + Intergenic
1175570879 20:60020638-60020660 CTCTGGAGTGTGTTATGCTCTGG - Intronic
1175871701 20:62212336-62212358 CTCTGGAAACTGCTGCTCCCTGG - Intergenic
1176197674 20:63844817-63844839 CTTTGCAGTCTGCTTGTCTCTGG - Intergenic
1176312317 21:5158684-5158706 CTCTTGAGGCTGCTGCTGTCCGG + Intergenic
1176584359 21:8563797-8563819 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1177902065 21:26928782-26928804 TTATGGTGTCTGCTCTTCTCTGG + Intronic
1178951559 21:36990040-36990062 CTCAGGAGACGGCTGTTCCCTGG + Intronic
1179844731 21:44103346-44103368 CTCTTGAGGCTGCTGCTGTCCGG - Exonic
1179941575 21:44642337-44642359 CTCTGGCTTCTTCTGATCTCTGG - Intronic
1180134446 21:45853127-45853149 CTCTGGAGCCTGCTGTGACCTGG + Intronic
1180267171 22:10540701-10540723 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1181667570 22:24408739-24408761 CTCTTGGGTCTGCTGTCCTTTGG + Intronic
1181765679 22:25090189-25090211 CACTGGAGTGTGCTGAGCTCTGG + Intronic
1183361760 22:37386552-37386574 CTCTGGAGAAAGCTGGTCTCAGG - Intronic
1183619356 22:38963655-38963677 CTCTGGAGCCTCCTGTCCCCGGG - Intronic
1184480017 22:44740902-44740924 TTCTGGAGTCTTCCCTTCTCTGG - Intronic
1184549067 22:45194769-45194791 CGGTGGAGTCTGCCTTTCTCAGG - Intronic
1203288261 22_KI270735v1_random:5047-5069 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1203326087 22_KI270738v1_random:20952-20974 CAGTGGATTATGCTGTTCTCAGG - Intergenic
949893327 3:8749465-8749487 CCCAGGACTCTGCTGTTCCCAGG - Intronic
950362926 3:12462464-12462486 CTGTGGAGTTTGCTGTGCCCTGG - Intergenic
950416815 3:12873519-12873541 CTAGGGAGTCTGCCCTTCTCAGG - Intergenic
950565433 3:13767165-13767187 CTCTGGACTGTGCTCTGCTCAGG - Intergenic
952805263 3:37343703-37343725 CCCTGGAGTCCTCTGTTCCCTGG + Intronic
952906606 3:38143206-38143228 CTCAGGAGACTGCCCTTCTCTGG + Intergenic
954450695 3:50569790-50569812 TTCTGGAGTCTGGTGGACTCGGG + Intronic
954942322 3:54385425-54385447 CTCTGGCCTCTGATGTTCTCTGG + Intronic
958068475 3:88577269-88577291 GTCTGAATTCTGCTGTTTTCTGG - Intergenic
959310170 3:104726026-104726048 ATTTGGAGTCTGATGTTCTAGGG + Intergenic
959741002 3:109719563-109719585 ATCTGGACTCTTGTGTTCTCAGG + Intergenic
960056321 3:113278985-113279007 CTCTGGCCTCTGCTGCTCTCTGG - Intronic
960208009 3:114926483-114926505 CTCTGTAACCTTCTGTTCTCAGG - Intronic
961633650 3:128319271-128319293 CTCTGAAGCCTGCTGTCCCCTGG - Intronic
961726611 3:128934945-128934967 CTGTGGCGTCTACTGTTCTTGGG - Intronic
963842219 3:150119425-150119447 CTCTGAAGCCTGCTGTTCAAAGG + Intergenic
964219807 3:154330411-154330433 CTCTGTTGTGTGCTGTTCTTTGG + Intergenic
964273827 3:154987427-154987449 CTCTGGTGTGTGCCCTTCTCTGG + Intergenic
964626263 3:158762901-158762923 CTCTGGAGGATCATGTTCTCAGG - Intronic
964629630 3:158795977-158795999 CTCTGGAGTCTTCTTTAATCAGG + Intronic
965826491 3:172736010-172736032 CTCTGTAGTGTTCTTTTCTCAGG + Intergenic
965901250 3:173644573-173644595 CCCTGGAGTATGCTGTGCCCTGG + Intronic
966046395 3:175556024-175556046 CTCTGGAGTCTGCTGTTCTCTGG - Intronic
967120816 3:186381249-186381271 ATCGGGAGACTGCTTTTCTCTGG - Intergenic
967871274 3:194231901-194231923 GTGTGGAGGCTGCTGCTCTCTGG + Intergenic
968208640 3:196827224-196827246 CTCTGGATTCTGAAGTTCTGGGG - Exonic
968520539 4:1032923-1032945 CTCTGGGGTCTCCTGGTGTCTGG + Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968712053 4:2126549-2126571 CTCTGGTCTCTGCTCCTCTCTGG - Intronic
969234476 4:5855895-5855917 CTCTGCAGCCTGCTGTGCCCAGG - Intronic
970479987 4:16463117-16463139 TTCTTGACTCTGCTGTTATCAGG + Intergenic
970531491 4:16989952-16989974 CTCTGGACTCTGCATTTTTCAGG - Intergenic
970540028 4:17068382-17068404 CTCTGGAATCAGCTGCTCTGTGG - Intergenic
970940043 4:21621314-21621336 CCCTGAAGTGTGCTGTTCACAGG + Intronic
972309723 4:37868948-37868970 CCCTGGAGTCTGCATTTCTGTGG + Intergenic
974027570 4:56747075-56747097 TTCTGGCATCTGCTGCTCTCTGG + Intergenic
974264763 4:59571076-59571098 CTGTGCAGTCAGCTGTTCGCTGG - Intergenic
974882897 4:67781198-67781220 CTCTGAAGTCTGCTGTTTGGAGG + Intergenic
976010150 4:80476904-80476926 CCCTGGAGCCTGCTTTTCTCAGG + Intronic
977071513 4:92394488-92394510 TTTTGGAGTCTGTTGTTCACTGG + Intronic
980879163 4:138691985-138692007 CCCTGGAGTCTGATGTTCAAGGG + Intergenic
982149014 4:152431465-152431487 GACTGGAATCTCCTGTTCTCAGG + Intronic
982553238 4:156828851-156828873 CTCTGGAGTCTGCATTTTTTTGG - Intronic
982913498 4:161175579-161175601 GCTTGGAGTCTGCTGTTCTAGGG - Intergenic
985890644 5:2712891-2712913 TACTGAAGTCTGATGTTCTCTGG + Intergenic
985954148 5:3250038-3250060 TCCTGGAGTTTGGTGTTCTCAGG + Intergenic
988307931 5:29517888-29517910 CTCTGCAGTATGCAGTGCTCAGG - Intergenic
988528208 5:32004674-32004696 CTCTGAAGTCTGGTGGACTCAGG - Intronic
991089707 5:62682492-62682514 GACTGGAGTCTTCTGGTCTCAGG - Intergenic
993155533 5:84217568-84217590 CTCTTGAGGCTCCTCTTCTCAGG - Intronic
996593465 5:125175070-125175092 CTCTTGAATCTGATGTTCTGGGG - Intergenic
997640006 5:135442826-135442848 CCCTGGAGGCTGCATTTCTCAGG + Intergenic
998186613 5:139985014-139985036 CTCTGAAGTCTGCTCTTCCCAGG - Intronic
1001134390 5:169090386-169090408 CTCTGCAGGCTGCAGTTCCCAGG - Intronic
1002342551 5:178526528-178526550 CTCTGGAGTTTACTGGTTTCAGG - Intronic
1003046001 6:2733392-2733414 TTCTGAGGTCTGCTGGTCTCTGG - Intronic
1003586088 6:7390276-7390298 CAAGGGAGTCTGCGGTTCTCAGG + Intronic
1005514210 6:26538701-26538723 CTCTGGATTCAGCTTTTCCCAGG - Intronic
1006166548 6:32068753-32068775 CGCGGGACTCTGCTGTCCTCTGG + Intronic
1007253893 6:40515330-40515352 CTCCTGGGTCTGCTGTTTTCAGG - Intronic
1008714030 6:54266668-54266690 CTATGGTCTCTGCTGCTCTCAGG - Intergenic
1012439549 6:99250688-99250710 CTCTGGTGTCTGTTCTCCTCAGG - Intergenic
1013878026 6:114857772-114857794 CTCTGCCTTCTGCTCTTCTCTGG + Intergenic
1015044214 6:128759690-128759712 CTCTGGAGTGTGCCCTCCTCTGG + Intergenic
1015123550 6:129727404-129727426 TTCTTGATTTTGCTGTTCTCAGG - Intergenic
1018859500 6:167700465-167700487 CCCTGGACTCTGCTGTTCATCGG - Intergenic
1019407486 7:891336-891358 CTGTGGTCTCTGCTGTACTCAGG + Intronic
1019710409 7:2515830-2515852 AGCTGGAGTCTGCTAGTCTCAGG + Intronic
1020951704 7:14687208-14687230 CTCAGGAGTCTCATGTCCTCTGG + Intronic
1021329279 7:19315019-19315041 CCCTGTGGTTTGCTGTTCTCAGG + Intergenic
1021414340 7:20365050-20365072 CTCTGAAGCCTGATGTTCTATGG - Intronic
1022660780 7:32364735-32364757 CTCTGGAGTGTGCCCTCCTCTGG + Intergenic
1022953719 7:35362745-35362767 GTGTGGAGTTTGCTGTTCTTGGG + Intergenic
1023299788 7:38758017-38758039 CTCTGGATTCTGCTCTTCTAGGG - Intronic
1023982878 7:45079971-45079993 CTCTGGTGTCCCCTGCTCTCTGG - Intergenic
1024431375 7:49291944-49291966 CTTGGGAGTCTGATGTTCGCAGG + Intergenic
1024730078 7:52243982-52244004 CTCTGGCGTCTCCAGTTCTGCGG - Intergenic
1024757549 7:52553222-52553244 TTCTGGAGCCTGCTGTTCCAAGG + Intergenic
1025306295 7:57861689-57861711 CAGTGGATTATGCTGTTCTCAGG - Intergenic
1025319062 7:58071950-58071972 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1025477472 7:60942430-60942452 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1025482899 7:61006684-61006706 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1025562984 7:62393613-62393635 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1025564210 7:62411038-62411060 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1026127984 7:67596441-67596463 GTCTGCAGTCTGCTGTGCACAGG + Intergenic
1026853295 7:73737912-73737934 CCCTGGGGCCTGCTCTTCTCTGG - Intronic
1028678956 7:93503223-93503245 GTCTGGAATATGCTGTTCTCAGG + Intronic
1029208458 7:98884648-98884670 CTCTGTGGTTTGCTTTTCTCTGG + Intronic
1030072403 7:105709397-105709419 CTGGGGAGACTGCTCTTCTCAGG + Intronic
1030583969 7:111393498-111393520 CTCTATTGTCTGCTGTGCTCAGG + Intronic
1031252458 7:119404521-119404543 CTCTTGTGTCTGCTGTTATCTGG - Intergenic
1032012972 7:128359149-128359171 CTCTGGAGTTTCGGGTTCTCTGG - Exonic
1032304908 7:130723418-130723440 CTGTGTCCTCTGCTGTTCTCTGG - Intergenic
1032513945 7:132493254-132493276 GTCTGGACTCTGCTATTATCAGG + Intronic
1033694239 7:143771077-143771099 CCCATGAGTCTGCTGATCTCTGG + Intergenic
1033910219 7:146254242-146254264 CTTTGGATTCTGCTATTCTCTGG + Intronic
1035444408 7:158930006-158930028 CTCAGAAATCTGCTGGTCTCCGG - Intronic
1036145112 8:6247772-6247794 CTCTGGTTTCTGCTCTTCTAAGG - Intergenic
1037135103 8:15450996-15451018 TTCTGGAAGCTGCAGTTCTCAGG - Intronic
1038900828 8:31841848-31841870 CTCTGCAGCCTGATGTTATCTGG - Intronic
1038932261 8:32207184-32207206 CTCTGGGGTATGCTATTTTCAGG + Intronic
1039368568 8:36959931-36959953 CTCTTGTGTCTGAGGTTCTCAGG + Intergenic
1039753462 8:40498039-40498061 CTCTGGAGTGGGCTGGACTCGGG + Intergenic
1040565787 8:48565530-48565552 CCCTGGAGTCTGATGCTCACAGG + Intergenic
1040913021 8:52540787-52540809 CTCTGGAGTCTGCTTCTCGTGGG + Intronic
1041392093 8:57355992-57356014 ATCTGGACTCTGCTGCTCTGAGG + Intergenic
1042659188 8:71134917-71134939 CTCTGGTGTCAGCTGGTTTCCGG - Intergenic
1043192493 8:77243881-77243903 GACTGGAATCTGCTGTTTTCAGG - Intergenic
1043341973 8:79250764-79250786 CTGTGGATTCTGTTGTTCTGTGG + Intergenic
1046823782 8:118664426-118664448 CTATGGAGTCTGCTCAACTCTGG - Intergenic
1048246859 8:132813521-132813543 GTCTGCTGTCTGCAGTTCTCTGG - Intronic
1048270745 8:133026252-133026274 CTCTGGAGTCTGGGGCTCTCAGG - Intronic
1048916437 8:139188626-139188648 ACCTGGAGTCTACTGTTCTAAGG + Intergenic
1049698453 8:143995072-143995094 CTCTGGAGCTTGCCGTTCCCAGG - Intronic
1050022825 9:1302709-1302731 GTCTGCAGTCTGCATTTCTCTGG - Intergenic
1050268198 9:3913563-3913585 ATCTGGAGTCCCCTTTTCTCTGG + Intronic
1051977201 9:22965386-22965408 TTCTGGAATCTCCTGTTTTCAGG + Intergenic
1052194446 9:25694357-25694379 GACTGGAGTCTTCTGTTTTCAGG - Intergenic
1052741201 9:32394619-32394641 CTCTGGAGTCTGATGGACTTGGG + Intronic
1052869453 9:33489443-33489465 TTTTGGAGTCTGCTGATCTAGGG + Intergenic
1053490774 9:38499963-38499985 CACTGTATTCTGCTGCTCTCTGG - Intergenic
1057008839 9:91583913-91583935 CTCATGGGTCTGCAGTTCTCAGG + Intronic
1057232462 9:93332082-93332104 CTCTGGAGTCTTCAATTCTCAGG + Intronic
1057526109 9:95803252-95803274 CTCTGTAGTCTGCTCCTCTTAGG + Intergenic
1057535421 9:95899003-95899025 CTCTGGATTCAGTTGTTCCCTGG + Intronic
1057541501 9:95976503-95976525 TTCTGGGGTCTCCTGTTCTTAGG + Intronic
1057688947 9:97265642-97265664 TTTTGGAGTCTGCTGATCTAGGG - Intergenic
1057866394 9:98685194-98685216 CTTGGGAGTCTGATGTTCTAGGG - Intronic
1058684045 9:107465401-107465423 CTCTGGAGTCTGCTCCTCTGTGG - Intergenic
1058881143 9:109286912-109286934 CTCTGGAGTCTACTGTGTTTGGG - Intronic
1058950106 9:109895279-109895301 CAGTGGAGTCTGCTGGTCTTGGG + Intronic
1059898720 9:118897941-118897963 CTCTGGAGACTCCAGCTCTCAGG + Intergenic
1060092138 9:120752683-120752705 TTTTGGATTCTCCTGTTCTCAGG + Intronic
1060103117 9:120857222-120857244 CCCAGAAGTCTTCTGTTCTCTGG - Exonic
1060875284 9:127078670-127078692 ATCTGCAGTCAGCTTTTCTCTGG + Intronic
1062065959 9:134526341-134526363 CCCTGAAGGCTCCTGTTCTCCGG - Intergenic
1062503881 9:136863070-136863092 CCCTAGAAGCTGCTGTTCTCAGG - Intronic
1203614263 Un_KI270749v1:41327-41349 CAGTGGATTATGCTGTTCTCAGG + Intergenic
1185834740 X:3334785-3334807 CTCTGGAGTCAGCTGAAATCAGG - Intronic
1188192378 X:27187936-27187958 CTCTGAAGCCTGCTGCTTTCAGG + Intergenic
1189252886 X:39614612-39614634 CTCTGGCCTCTGCTGTTTTGTGG - Intergenic
1189350289 X:40270755-40270777 TTCTGGAGCCTGCTGTGCCCTGG - Intergenic
1192330712 X:70173170-70173192 CACTGGAGGCCGCTGTTCCCTGG + Intergenic
1193468981 X:81876521-81876543 CTCTGGAATCTGCTGTCCCAGGG - Intergenic
1194230303 X:91314437-91314459 ACCTGGAGTCTGATGTTCTAGGG + Intergenic
1196513916 X:116547150-116547172 CTCTGAAGTGTACTATTCTCAGG - Intergenic
1198412169 X:136381825-136381847 ATTTGGAGTCTGATGTTCTAAGG + Intronic
1199068738 X:143451424-143451446 ATCTGGAGTCTGATGTTCAAGGG - Intergenic
1200391816 X:155953062-155953084 CTCTGGGGTCTGCTCTCCTCTGG - Intergenic
1201147042 Y:11070601-11070623 ATCAGGTGTCTGCTGTTCCCAGG - Intergenic
1201400943 Y:13603115-13603137 CTGGGGAGGCTGCTTTTCTCTGG + Intergenic