ID: 966047480

View in Genome Browser
Species Human (GRCh38)
Location 3:175570273-175570295
Sequence AGGGGTGTCCACATTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966047474_966047480 14 Left 966047474 3:175570236-175570258 CCTTTTTGTTCCATTCAGGTCTT 0: 1
1: 24
2: 156
3: 377
4: 910
Right 966047480 3:175570273-175570295 AGGGGTGTCCACATTGAGTAGGG 0: 1
1: 0
2: 0
3: 15
4: 98
966047475_966047480 4 Left 966047475 3:175570246-175570268 CCATTCAGGTCTTCAGCTGATGA 0: 1
1: 0
2: 1
3: 35
4: 228
Right 966047480 3:175570273-175570295 AGGGGTGTCCACATTGAGTAGGG 0: 1
1: 0
2: 0
3: 15
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966047480 Original CRISPR AGGGGTGTCCACATTGAGTA GGG Intronic
903663751 1:24994636-24994658 TGGGGTGTCCTCACTGAGCAAGG + Intergenic
914239898 1:145846357-145846379 AGGAGTGTCAACAGTGAGTGGGG + Intronic
916938558 1:169656581-169656603 AGGGGTGTCCACAATTACTGAGG + Intergenic
918146127 1:181757732-181757754 AGGTGTTGCCACATGGAGTAGGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921897361 1:220414412-220414434 AGTGGTGTCCAAAGTAAGTATGG + Intergenic
922394453 1:225182235-225182257 TGAGGTGTCCACATTTAATAAGG - Intronic
922542000 1:226426878-226426900 TGGGGTGTCCACACTAAGTCTGG - Intergenic
1066379858 10:34892026-34892048 AGGGGTTTCAACATTAACTAGGG + Intergenic
1073449571 10:103601603-103601625 GGGGGTGCCCACACTGAGTGAGG - Exonic
1075280884 10:121137273-121137295 GGTGGTGTCCACAGTGAGTCTGG + Intergenic
1077992179 11:7422112-7422134 AGGGGTGCCCACACTGGGTGAGG - Intronic
1082971254 11:59023753-59023775 AAGGGTGTCCACTTTCACTAGGG - Intronic
1091049123 11:132351953-132351975 AGGGGAGTCCAGATTGACTTAGG + Intergenic
1091665324 12:2414769-2414791 AGGGCTGCCCACATTCAGTAAGG - Intronic
1093732532 12:22582215-22582237 GGTTGTGTTCACATTGAGTAAGG + Intergenic
1095083158 12:38030724-38030746 AGGGTTGTCCTCATTGTTTATGG - Intergenic
1097534505 12:60849821-60849843 GGGTGTGTCCACATTGGGTGAGG - Intergenic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1107648175 13:42516599-42516621 AGGGGTGTCCACAATTACTGAGG + Intergenic
1117678534 14:58179873-58179895 TGGGGTGTCCACACTGAGTGTGG + Intronic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1122398879 14:101455420-101455442 AGGGGAGTCCACAGTGGGTGGGG + Intergenic
1122532422 14:102437854-102437876 AGGGGTGTCCACAGATAGCAGGG + Intronic
1123778165 15:23600919-23600941 AGGGGTGTCCCCACTAACTAGGG + Intronic
1124882141 15:33652435-33652457 AGGTGTGTTGACATTGAGTCTGG + Intronic
1127772823 15:62244491-62244513 CGGGGTGTCCGCACTGAGTTCGG - Intergenic
1127860937 15:62993981-62994003 AGCTGTGCCCACATTGAGTATGG + Intergenic
1130990397 15:88872546-88872568 AGGGCTGACCACATTGGGTAGGG - Intronic
1131000294 15:88934363-88934385 AGGGGTGTACAAATAGGGTATGG + Intergenic
1132715119 16:1286283-1286305 AGGGGTGTCCACAAGGAAGACGG + Intergenic
1137710459 16:50563342-50563364 AGGGCTGTGCCCATTGAGGATGG - Intronic
1137710494 16:50563522-50563544 AGGGCTGTGCCCATTGAGGATGG - Intronic
1138399754 16:56735851-56735873 AGAGGTGGCCACAGAGAGTAGGG + Intronic
1141087776 16:81109023-81109045 AGGGGTGTCTACCTAGAGGAGGG + Intergenic
1144830315 17:18127431-18127453 AGGGGAGTCCACATAGGGAAGGG + Intronic
1148354731 17:46968278-46968300 AGGGGTGTCCACAGTGCGGAGGG - Intronic
1149264157 17:54909348-54909370 AGGGGTGTCATCATAGAGTGGGG + Intronic
1150477663 17:65487225-65487247 AGGGTTGGCCCCATGGAGTAGGG - Intergenic
1151513595 17:74578069-74578091 TGGGGTGTCCACACTGGGTGGGG + Intergenic
1156388382 18:36626962-36626984 AGGGGTGTCAACATAGACCATGG - Intronic
1163071464 19:14845590-14845612 AGGAGCTACCACATTGAGTAGGG + Intergenic
1163616715 19:18333378-18333400 TTGGGTGTCCACATTAAGTCTGG + Intergenic
1166846938 19:45734188-45734210 TGGAGTGCCCACATTGAGTATGG + Intronic
925287406 2:2724812-2724834 AGGGGTGTCAGCATGGAGGATGG - Intergenic
928527979 2:32161846-32161868 AGGGGTGTCCATATGGGGTAAGG + Intergenic
928903221 2:36343976-36343998 AGGGGTTTTCATATTGACTAAGG + Intergenic
933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG + Intergenic
942388205 2:175464058-175464080 AGGGGATTCCACAGTGAGCAGGG - Intergenic
944121366 2:196244162-196244184 ATGGATGTCCAAAATGAGTAAGG + Intronic
947153333 2:227136075-227136097 AAGGGTGTCCACAGTGGGTCAGG + Intronic
948627976 2:239281177-239281199 AGGGGTGTGTACATTGAGAGTGG - Intronic
1170056871 20:12215074-12215096 AGGGCTGTCGATATTGGGTAGGG - Intergenic
1172525775 20:35600037-35600059 AGGGGTGTTGACTTTCAGTAAGG - Intergenic
1173240356 20:41290454-41290476 TCGGGTGTCCACACTGAGTTTGG - Intronic
1175087338 20:56470836-56470858 AGGGCTGTCCTCATGGAGTTGGG - Intronic
1176040157 20:63060944-63060966 AGGGGTGACCACAGTGGTTAGGG + Intergenic
1177451666 21:21276036-21276058 AGGGCATTCCACATTGGGTAAGG - Intronic
1178385489 21:32145601-32145623 AGGGGAGTGCACATTCAGTTTGG + Intergenic
1178789369 21:35685228-35685250 AGGGTTGTCCACATGGAGAAGGG + Intronic
1179658820 21:42861991-42862013 AGGGGTCTCCACACTGAGACAGG + Intronic
953879908 3:46686255-46686277 AGGGGGTTCCACATTGGGCATGG - Intronic
960878528 3:122321229-122321251 AGGGGTCTCGCCATGGAGTATGG + Intergenic
966047480 3:175570273-175570295 AGGGGTGTCCACATTGAGTAGGG + Intronic
969568082 4:7992047-7992069 AGGGGTCTCCCCATTGCGCAAGG - Intronic
970685252 4:18559734-18559756 AGGGGTGTCCACCATTACTAAGG + Intergenic
974034507 4:56805936-56805958 ATGGGTGTCCACACTAAGTTTGG + Intergenic
983013784 4:162583305-162583327 AGGGGTTTTGACATTGTGTAAGG - Intergenic
983304337 4:165966721-165966743 AGGGGTGTACAAATAGGGTATGG + Intronic
986605178 5:9515855-9515877 ATGGGTCTCCACCTTGACTAGGG - Intronic
987480014 5:18441493-18441515 ATGTATGTCCACAGTGAGTAGGG - Intergenic
995888103 5:116918699-116918721 AGGGGTGCCTACATTTAGTATGG - Intergenic
995888117 5:116918784-116918806 AGGGGTGCCTACATTTAGTATGG - Intergenic
997524743 5:134544913-134544935 AGGGGTGGCCAGATTGTGTTGGG + Intronic
998053399 5:139055226-139055248 AGCCCTGTCCATATTGAGTAAGG + Intronic
1001564359 5:172689947-172689969 AGGGGTGTCCACAGTTAGGAAGG + Exonic
1003795883 6:9602651-9602673 ATGGGTGTCACCATTGAGCACGG - Intronic
1006672935 6:35741039-35741061 ACGGGTGTGCTCAGTGAGTACGG + Intronic
1007803588 6:44419468-44419490 TGGGGTGTCCACATTGGTGAGGG - Exonic
1010338643 6:74721361-74721383 AGGGGTGTGCACAGAGAGAAAGG - Intergenic
1010462370 6:76128034-76128056 AGGGATGTCCACAGTGTGTGGGG - Intergenic
1015378999 6:132545444-132545466 ATGGTTGCCCACATTGAGCAAGG + Intergenic
1016439753 6:144070812-144070834 AAGGGGTTCCACAGTGAGTAGGG - Intergenic
1017315294 6:153024181-153024203 ATGGCTGTCCACATTGGGTAGGG - Intronic
1023637552 7:42227875-42227897 AGGCGAGTCCCCATTGATTATGG + Intronic
1028427629 7:90707658-90707680 AGTGGTGACCACTGTGAGTATGG + Intronic
1032070881 7:128805968-128805990 CGGGGTGGGCACAGTGAGTATGG + Intronic
1032205978 7:129865923-129865945 AGGGGTGTTCCAATTGAGTAAGG + Intronic
1032287093 7:130547148-130547170 ATGTGTGTCCACATTAAGAAGGG - Intronic
1036288354 8:7464098-7464120 AGGGGGGTCCAAAGTGAGGAAGG - Intergenic
1036333121 8:7847430-7847452 AGGGGGGTCCAAAGTGAGGAAGG + Intergenic
1040376314 8:46828139-46828161 AGGGGAGTCCACATATAGGAAGG + Intergenic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1042911661 8:73833938-73833960 TTGGGTGTCCACATTGAGTTCGG - Intronic
1044999682 8:97868976-97868998 AGGGGTGTCCTCTTTGGGGATGG - Intronic
1046027800 8:108746342-108746364 AGGGGTGTCTGCATTGCCTAGGG - Intronic
1046702411 8:117416425-117416447 AGGGGTGTTCACATTGGAAACGG - Intergenic
1046972533 8:120238431-120238453 AGGGGTGTCCGCCATTAGTAAGG - Intronic
1048068633 8:130999075-130999097 GGGGGAGTTCAGATTGAGTAAGG - Intronic
1053226235 9:36360610-36360632 AGGGGTGTCCAACCTGAATAAGG + Intronic
1059255163 9:112923717-112923739 AGGTCTGTCCATGTTGAGTATGG + Intergenic
1062145801 9:134989030-134989052 AGGGGTGTCCAGACTGTGTGAGG + Intergenic
1189467931 X:41291659-41291681 AGGGGTGTCTACAGTTAGTTGGG - Intergenic
1189578118 X:42376795-42376817 AGGTGTGCCCACATTGCGTTTGG + Intergenic
1189629165 X:42933707-42933729 TGGGTAATCCACATTGAGTACGG + Intergenic
1190629169 X:52368493-52368515 AGGGGCGTTCACACTGAGTCAGG - Intergenic
1190630417 X:52380677-52380699 AGGGGTGTACACACAGAGTCAGG - Intergenic
1191000880 X:55658521-55658543 AGGGATGTGCACACTGAGTCAGG + Intergenic
1191153262 X:57243069-57243091 AGGGGTGTCCACTATTACTAAGG + Intergenic
1195486963 X:105420313-105420335 AGAGGATTCCGCATTGAGTAAGG - Intronic
1195845986 X:109229206-109229228 AGGGGTGTCCACAATTCCTAAGG + Intergenic
1196185256 X:112738654-112738676 AGAGGAGTTCACATTTAGTAGGG - Intergenic
1202193302 Y:22267981-22268003 AGGGATGTCTACATTGATTTGGG + Intergenic