ID: 966047948

View in Genome Browser
Species Human (GRCh38)
Location 3:175575866-175575888
Sequence CCTAATGGGTGGTAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966047948_966047952 -10 Left 966047948 3:175575866-175575888 CCTGGGCTCTACCACCCATTAGG 0: 1
1: 0
2: 1
3: 3
4: 112
Right 966047952 3:175575879-175575901 ACCCATTAGGTAGGACAGTGTGG 0: 1
1: 0
2: 4
3: 20
4: 678
966047948_966047959 25 Left 966047948 3:175575866-175575888 CCTGGGCTCTACCACCCATTAGG 0: 1
1: 0
2: 1
3: 3
4: 112
Right 966047959 3:175575914-175575936 TGCATTTTTAACAGTCTCCAGGG 0: 1
1: 2
2: 16
3: 130
4: 869
966047948_966047956 -8 Left 966047948 3:175575866-175575888 CCTGGGCTCTACCACCCATTAGG 0: 1
1: 0
2: 1
3: 3
4: 112
Right 966047956 3:175575881-175575903 CCATTAGGTAGGACAGTGTGGGG 0: 1
1: 0
2: 1
3: 14
4: 245
966047948_966047958 24 Left 966047948 3:175575866-175575888 CCTGGGCTCTACCACCCATTAGG 0: 1
1: 0
2: 1
3: 3
4: 112
Right 966047958 3:175575913-175575935 TTGCATTTTTAACAGTCTCCAGG 0: 1
1: 1
2: 11
3: 80
4: 539
966047948_966047954 -9 Left 966047948 3:175575866-175575888 CCTGGGCTCTACCACCCATTAGG 0: 1
1: 0
2: 1
3: 3
4: 112
Right 966047954 3:175575880-175575902 CCCATTAGGTAGGACAGTGTGGG 0: 1
1: 0
2: 3
3: 27
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966047948 Original CRISPR CCTAATGGGTGGTAGAGCCC AGG (reversed) Intronic
902988944 1:20172593-20172615 ACTCATGGGTGGGAGAGACCAGG + Intronic
903348176 1:22701168-22701190 CCTAAGAGAGGGTAGAGCCCTGG - Intergenic
904249224 1:29210740-29210762 ACTAGTGAGTGGTAGAGCCAGGG - Intronic
911259466 1:95669204-95669226 CCTGCTGATTGGTAGAGCCCAGG + Intergenic
921166048 1:212507967-212507989 CCTTATTGGTGGCAGAGCCTGGG - Intergenic
921419047 1:214924659-214924681 CCTAATGGGAAGTAGAGCGAGGG - Intergenic
923456842 1:234172099-234172121 CCAACTGGGTGCTAGAGGCCAGG - Intronic
1064280166 10:13944234-13944256 TCTGATGGGAGGTGGAGCCCAGG - Intronic
1065850772 10:29785723-29785745 CCTGGTGGGTGGGAGAGTCCGGG - Intergenic
1070681367 10:78451583-78451605 CCTGACAGCTGGTAGAGCCCTGG - Intergenic
1075636662 10:124034958-124034980 CCTATTAGGGGGTAGAGCCAGGG - Intronic
1075636671 10:124034983-124035005 CCTATTAGGGGGTAGAGCCAGGG - Intronic
1078010680 11:7570784-7570806 GCTCATGAGTGGTAGAGCCAGGG - Intronic
1082784846 11:57311238-57311260 CCTTGTGGGCGGGAGAGCCCTGG + Intronic
1083330765 11:61897421-61897443 TCTGATGGGTGGGAGGGCCCAGG + Exonic
1084480857 11:69419234-69419256 CCCAAGGGGTGGTTGTGCCCTGG + Intergenic
1085058486 11:73423006-73423028 GCTAATAAGTGGCAGAGCCCAGG - Intronic
1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG + Intronic
1087160364 11:94942715-94942737 GCTAGTGGGTGGTAAAGTCCAGG + Intergenic
1093923895 12:24889975-24889997 CCTAAAGGGTGGCACACCCCGGG + Intronic
1094494717 12:30982183-30982205 ACCACTGGGTGGCAGAGCCCAGG - Intronic
1097923852 12:65106250-65106272 CCCACAGGCTGGTAGAGCCCAGG + Intronic
1097924106 12:65108786-65108808 CCTATTGACTGGTAGAGTCCAGG - Intronic
1100665233 12:96744846-96744868 CCTACTGGGGGGTAGAGCAAGGG - Intronic
1104896006 12:132163893-132163915 CCTCATGGGTGGCTCAGCCCTGG + Intergenic
1106449482 13:29867025-29867047 GCAGATGTGTGGTAGAGCCCAGG - Intergenic
1119300202 14:73565937-73565959 CCTGCTGATTGGTAGAGCCCAGG + Intergenic
1122810745 14:104286661-104286683 CCAACAGGGTGGCAGAGCCCTGG - Intergenic
1128145111 15:65328719-65328741 CCTGATGGGTGTTAGGGCCGGGG + Exonic
1135287766 16:21208930-21208952 CCTGATTAGTGGTAGAGCCAGGG + Intronic
1137070492 16:35900435-35900457 CCAAATGGGTGGTAGAATGCAGG + Intergenic
1138763132 16:59567769-59567791 CCTCAATGGTGGTAGAGCTCTGG - Intergenic
1140045240 16:71436318-71436340 CCTAATGGGTTGTCAAGCCCTGG + Intergenic
1146551519 17:33784143-33784165 CCTAATGAGTGGTGGAGCCAGGG - Intronic
1146841210 17:36155663-36155685 GATAATGAGTGGGAGAGCCCAGG + Intergenic
1146842168 17:36163749-36163771 TCTAGGGGGTGGTAGGGCCCAGG - Intergenic
1146854476 17:36251708-36251730 TCTAGGGGGTGGTAGGGCCCAGG - Intronic
1146866141 17:36336668-36336690 TCTAGGGGGTGGTAGGGCCCAGG + Intronic
1146870378 17:36375600-36375622 TCTAGGGGGTGGTAGGGCCCAGG - Intronic
1146877735 17:36426681-36426703 TCTAGGGGGTGGTAGGGCCCAGG - Intronic
1147069012 17:37937280-37937302 TCTAGGGGGTGGTAGGGCCCAGG + Intergenic
1147073260 17:37976224-37976246 TCTAGGGGGTGGTAGGGCCCAGG - Intergenic
1147080537 17:38016817-38016839 TCTAGGGGGTGGTAGGGCCCAGG + Intronic
1147084781 17:38055762-38055784 TCTAGGGGGTGGTAGGGCCCAGG - Intronic
1147096483 17:38140777-38140799 TCTAGGGGGTGGTAGGGCCCAGG + Intergenic
1147100729 17:38179728-38179750 TCTAGGGGGTGGTAGGGCCCAGG - Intergenic
1149858365 17:60105496-60105518 GATAATGAGTGGGAGAGCCCAGG - Intergenic
1150082711 17:62254609-62254631 GATAATGAGTGGGAGAGCCCAGG + Intergenic
1150083663 17:62262775-62262797 TCTAGGGGGTGGTAGGGCCCAGG - Intergenic
1151671403 17:75573529-75573551 CCAAGTGGCTGGTGGAGCCCCGG + Exonic
1152434860 17:80270218-80270240 CCTGCTGGGTGGCAGAGCCAGGG - Intronic
1152630615 17:81409260-81409282 CTTAAAGGGTGTCAGAGCCCAGG + Intronic
1157021788 18:43792044-43792066 CCTAATTTGTGGCAGAGCCAGGG + Intergenic
1164195639 19:22955508-22955530 CCTGTTGGGGGGTAGGGCCCTGG + Intergenic
925285559 2:2713508-2713530 GCTTTTGGGTGGCAGAGCCCGGG + Intergenic
925445965 2:3927247-3927269 TCTAGTGAGTGGTGGAGCCCGGG + Intergenic
927933267 2:27059352-27059374 CCTTTTGGGTACTAGAGCCCAGG - Exonic
928489611 2:31768132-31768154 CTTGATGGTTGCTAGAGCCCAGG - Intergenic
929791914 2:45029622-45029644 CTTACTGGGTGGGAGAGCCTAGG + Intergenic
930419292 2:51130702-51130724 CCTAGTAAGTGGTAGTGCCCGGG - Intergenic
934223720 2:90110983-90111005 CCTGACAGGTGGTGGAGCCCTGG + Intergenic
935184363 2:100718242-100718264 CCTACAGGGTGGTACAGCACAGG - Intergenic
937356590 2:121201703-121201725 CTGAATGGGAGGTAGAGCCTGGG - Intergenic
937517716 2:122674175-122674197 CCCAATGGGCGCTCGAGCCCTGG + Intergenic
939905408 2:147907634-147907656 CCTAGTGGGTGGCAAAGCCTGGG + Intronic
941619312 2:167758479-167758501 CCTAATGGGTCATGGAGCACTGG + Intergenic
942408061 2:175676530-175676552 CCTAAAGTGTGGCAGAGCCATGG - Intergenic
942760766 2:179394767-179394789 TCTAGTGGGAGGGAGAGCCCTGG + Intergenic
947574615 2:231262861-231262883 GCTAATGAGTGGTAGAGCAGAGG - Intronic
947876017 2:233468757-233468779 CATAATGGGGGGCAGAGCCTTGG + Intronic
1174850455 20:53988942-53988964 ACTGATGGGTGGAATAGCCCAGG - Intronic
1174870705 20:54178621-54178643 GCTAATGAGTGGTGGAGCCATGG - Intergenic
1174923676 20:54732762-54732784 CCTTATGGGTGGAAGAGCTGAGG - Intergenic
1175901294 20:62360883-62360905 GCCAAGGGGTGGTGGAGCCCAGG + Intronic
1179998448 21:44984604-44984626 CTTCATGGGTGGCAGAGTCCTGG + Intergenic
1181788675 22:25246158-25246180 CCAACTGGCTGGTAGAGGCCAGG - Intergenic
1182082738 22:27540724-27540746 CCAAATGTGTCCTAGAGCCCAGG - Intergenic
1184208964 22:43024007-43024029 CCTAATGGCTGGCAGACCTCGGG - Intergenic
952580671 3:34830011-34830033 CCCAATATGTAGTAGAGCCCTGG - Intergenic
952952989 3:38539171-38539193 CCTAGTGGGAGGTAGAGGGCTGG + Intronic
952966706 3:38625554-38625576 CCCCATGGGTGGCAGAGGCCAGG - Intronic
956422692 3:69101183-69101205 CCTACTGTGTACTAGAGCCCAGG + Intronic
958114415 3:89196865-89196887 CCATTTGGGTGGTAGAGCCACGG - Intronic
962361912 3:134749915-134749937 GCTAATGGGTGTGAGCGCCCAGG + Intronic
964422196 3:156515199-156515221 CCTATTTTGTGGTAGAGCTCTGG - Exonic
964675965 3:159280043-159280065 TATAATGGGGGGTAGAGTCCTGG + Intronic
966047948 3:175575866-175575888 CCTAATGGGTGGTAGAGCCCAGG - Intronic
967008670 3:185410086-185410108 CCTGATGGGAGGCAGAGCTCAGG + Intronic
968003869 3:195226037-195226059 CTTAATGGGTTCTGGAGCCCTGG - Intronic
968793532 4:2686615-2686637 ACACATGGGTGGTGGAGCCCAGG + Intronic
973643913 4:52931324-52931346 GCTGTTGGGTGGTAGAGCCTGGG + Intronic
974590465 4:63942487-63942509 CCTGCTGATTGGTAGAGCCCAGG + Intergenic
984480235 4:180291483-180291505 TCTGATGGGAGGTAGAGCTCAGG - Intergenic
984575725 4:181446089-181446111 CCTCATGGAGCGTAGAGCCCAGG + Intergenic
990070073 5:51771403-51771425 CCTACTGGGTGATAGAACACTGG + Intergenic
991244035 5:64489968-64489990 CCTAAGGGGGGGTGGAGCACTGG - Intergenic
998155953 5:139787362-139787384 CCTAGTAAGTGGCAGAGCCCAGG - Intergenic
999539801 5:152558991-152559013 CATAATGAGTGGTAGAGTCAGGG - Intergenic
1005079570 6:21943755-21943777 CTGCATGGGTGGCAGAGCCCAGG - Intergenic
1006302494 6:33200989-33201011 CCTAATGAGTCGTAGAGACGAGG + Exonic
1006845159 6:37056554-37056576 CCTAGGGGGTGGGGGAGCCCAGG + Intergenic
1014747535 6:125217523-125217545 CCTGATGGGAGGCAGAGCTCAGG + Intronic
1023385049 7:39648255-39648277 CCTATTAGGTGGTAGAACCTAGG + Intronic
1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG + Intergenic
1037276883 8:17190020-17190042 CACAATGGGTGGGAGTGCCCAGG + Intronic
1039428074 8:37503316-37503338 CCAAATGGCTGGCAGAGCCAGGG + Intergenic
1040014601 8:42690270-42690292 CCTGCTGATTGGTAGAGCCCAGG - Intergenic
1040317390 8:46272101-46272123 CCAAGTGGGTTGTAAAGCCCCGG + Intergenic
1041221303 8:55654432-55654454 ACTAATTGGGGGTAGAGCCCGGG + Intergenic
1042522326 8:69726794-69726816 GCTAATAGGAGGTAGAGGCCGGG - Intronic
1042723567 8:71848939-71848961 CCTGATGGCTGGTAGAGCCCGGG - Intronic
1044401899 8:91782497-91782519 GCTCAGGGGTAGTAGAGCCCTGG + Intergenic
1053302434 9:36961408-36961430 CCCAATGGGAGGGAGGGCCCTGG + Intronic
1058967266 9:110049304-110049326 CCTTTTGGGTGGCAGAGCCGGGG + Intronic
1059607965 9:115856828-115856850 CCTAGTCAGTGATAGAGCCCAGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1190554898 X:51623851-51623873 CCTACTGGGTGGTACCTCCCAGG - Intergenic