ID: 966049047

View in Genome Browser
Species Human (GRCh38)
Location 3:175590901-175590923
Sequence GTGTGTGTGCTTAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 622}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966049047 Original CRISPR GTGTGTGTGCTTAGGGATGA AGG Intronic
900802240 1:4744612-4744634 GTGTGTGTGCATATGCATGTGGG - Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901233643 1:7655652-7655674 GTGTGTGTGCATAGGTGTGTGGG - Intronic
901435143 1:9242972-9242994 GTGTGTGTATTTAGGGGTGAGGG + Intronic
901504729 1:9677242-9677264 GTGTGTGTGTTTTGGGAGGGAGG + Intronic
902071377 1:13741754-13741776 GTGTGTGTGTGTAGGGGTGGGGG + Intronic
902125183 1:14203365-14203387 GAGTGTGTACTTAGGACTGAAGG + Intergenic
902482163 1:16717744-16717766 GGGTGAGTGCTGAGGGAGGAAGG - Intergenic
903090096 1:20906917-20906939 TTGGGTGTGCTGAGGAATGAAGG + Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903668067 1:25019866-25019888 GTGTGTGTGCACAGGCATGTAGG - Intergenic
903771848 1:25769290-25769312 GTGTGTGTGCTGAGGGGTATGGG - Intronic
904041994 1:27590491-27590513 GGGTGTGTGCTGAGGGGTGGTGG - Intronic
904911754 1:33939375-33939397 GTGTGTGTGCTTATGAGTGTGGG + Intronic
905591857 1:39170941-39170963 GTGTGTGTGCTATGGCGTGAGGG - Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906868239 1:49446960-49446982 CTGTCTGTGCCCAGGGATGAAGG - Intronic
907426898 1:54385476-54385498 GTGTGTGTGTTTGGGGTTGGGGG - Intronic
907774988 1:57505512-57505534 GTGGGTGTCCTTATGGAAGATGG + Intronic
908228109 1:62076512-62076534 GTATGTGTGGTGATGGATGAAGG - Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909790244 1:79668253-79668275 GTGGGTGTGCATAGGGAAGAAGG - Intergenic
910260332 1:85288095-85288117 GTGTGTGTGTTTTGTGGTGAGGG + Intergenic
910359437 1:86400417-86400439 GTGTGTGGGCTAGGGGAGGATGG - Intergenic
912442892 1:109712478-109712500 GTGTGTGTGTTTGGGGGTGGGGG + Intronic
912451717 1:109771498-109771520 GTGTGTCTGTGTTGGGATGAGGG + Intronic
913323824 1:117608899-117608921 GTGTGTGTGTTTAGGAGTTAAGG + Intronic
913693433 1:121301128-121301150 GTATGTGTGCTTGGGGACTAGGG - Intronic
913962874 1:143353385-143353407 GTGTGTCTGGTTAGGGGTGGAGG - Intergenic
914057229 1:144178970-144178992 GTGTGTCTGGTTAGGGGTGGAGG - Intergenic
914121917 1:144787396-144787418 GTGTGTCTGGTTAGGGGTGGAGG + Intergenic
914144123 1:144978952-144978974 GTATGTGTGCTTGGGGACTAGGG + Intronic
914959119 1:152190435-152190457 GTGTGTGTGGGTAGGGTTGGTGG + Intergenic
915162058 1:153927633-153927655 GTGTGTGTGTTTAGGAGAGACGG + Intergenic
915733557 1:158070698-158070720 GTGTGTGTGGTGAGGGTTGTGGG + Intronic
915782764 1:158571121-158571143 TTGTTTGTGCTTATGTATGAGGG + Intergenic
916493809 1:165326932-165326954 GTGTGTGTGTCTGGGGGTGAGGG - Intronic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
916801471 1:168220349-168220371 GTGTGTGTGTGTAGGGGTGGGGG - Intergenic
918439863 1:184556068-184556090 GTGTGTGTGTTTGGGGTTGGGGG - Intronic
920480757 1:206319497-206319519 GTATGTGTGCTTGGGGACTAGGG - Intronic
920657097 1:207885393-207885415 GTATGTATGCTTTGGGAGGAAGG - Intronic
920711712 1:208301702-208301724 GTGTGTGTGTTTATGTGTGAAGG + Intergenic
920819601 1:209368013-209368035 GTGAGTGTAGTCAGGGATGAAGG + Intergenic
922434452 1:225590070-225590092 GTGTGTGTGTTGAGTGATGAGGG - Intronic
922455198 1:225768620-225768642 CTGTCTGTGCGTAGGGGTGAGGG - Intergenic
923280140 1:232435972-232435994 GTGTGTGTGCCTGGGGCTGGAGG + Intronic
923370566 1:233307792-233307814 GTCTGTGTGCTAAGGGATTGTGG + Intergenic
923532698 1:234824042-234824064 GTGTGTGTGTTTGGGGCTGGAGG - Intergenic
923872828 1:238015106-238015128 GTGTGTGTATTTAGCGGTGAGGG + Intergenic
923965733 1:239136346-239136368 GTGTGTGTGGCTATGGATAATGG - Intergenic
924112450 1:240713531-240713553 GTGTGAGGGCTGAGGGCTGAGGG - Intergenic
924947807 1:248857905-248857927 GTGTGAGTGCCCAGGGCTGAGGG - Intronic
1062952238 10:1513427-1513449 GAGTGTGTGGCTAGCGATGACGG + Intronic
1063367091 10:5497289-5497311 GTCTGTGTGGTTAGGGTTGGGGG - Intergenic
1063601677 10:7487345-7487367 GTGTGTGTGGTGAGAGAAGAAGG - Intergenic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1066472004 10:35708298-35708320 GTGTGTGTGTTTAGGTATTTAGG + Intergenic
1067090891 10:43265470-43265492 GTGTGTGTCCTTAGGGCTGTGGG - Intronic
1067498631 10:46781860-46781882 GTGTGTGTGTTTGGGGGTGGGGG - Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067705212 10:48601588-48601610 GAGTGGGTGCTTATGGATGGTGG - Intronic
1067943670 10:50677291-50677313 GAGTCTGTGTTTAGGGAGGACGG + Intergenic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069463858 10:68620579-68620601 GTGTGTGTGTTTGGGGGTGGGGG - Intronic
1069817377 10:71207019-71207041 GGGTGGGTACTTAGGGATGGAGG - Intergenic
1070352851 10:75610335-75610357 GTGTTTGTGGTGAGGGATGTGGG - Intronic
1070664515 10:78333719-78333741 GTGTGTGTGGTGGGGGGTGATGG + Intergenic
1070847962 10:79539283-79539305 GTGTCTGTGGTTGGGGAGGAAGG + Intergenic
1070865156 10:79704158-79704180 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1070878947 10:79842289-79842311 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1071479432 10:86053793-86053815 GTGTGTCTGTGTAGGGATGGGGG - Intronic
1071632052 10:87226379-87226401 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1071645505 10:87358598-87358620 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1072111366 10:92323278-92323300 GTGTGTGTGGTCAGGGGTGGAGG - Intronic
1072427715 10:95343989-95344011 GTGCCTGTGGTTGGGGATGAAGG - Intronic
1072628729 10:97131269-97131291 GTGTGTGTGGTGAGAGATGCCGG - Intronic
1072759007 10:98040566-98040588 GTGTGTGTGTGTAGAGATGGGGG - Intergenic
1073042203 10:100615279-100615301 GTGTGTGGGTTTGGGGAGGAGGG + Intergenic
1073043936 10:100625166-100625188 GTGTCTGTGCTGAGGGCTGGAGG - Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1073632676 10:105164236-105164258 TTAAGTGTGCTTAGGGCTGAGGG - Intronic
1073682475 10:105719274-105719296 GTGTGTGTGTTTAAGCACGAGGG + Intergenic
1073752284 10:106542401-106542423 GTGTGTGTGTGTAGGGATATAGG - Intergenic
1073808870 10:107130897-107130919 GTGTTTCTGTTTGGGGATGATGG - Intronic
1073839561 10:107482707-107482729 GTCTGTGGGCATCGGGATGAAGG + Intergenic
1074095740 10:110310742-110310764 ACGTGTGTGTTTGGGGATGATGG + Intergenic
1074269655 10:111941319-111941341 ATGTGTGTGCTTGGTGATGGTGG - Intergenic
1074400177 10:113135192-113135214 GTGTGGGCGCTTGGCGATGAGGG + Intronic
1074490938 10:113939039-113939061 GTGTGTGAGCTCAGGGATAGAGG - Intergenic
1074703291 10:116110721-116110743 TTGTGGGTGCTTAGTGATCATGG - Intronic
1074881709 10:117664836-117664858 GTGTGTGTGCCAGGGGAGGAGGG - Intergenic
1075502555 10:122989161-122989183 GTGTGGTTGCTTAGAGATGGGGG + Intronic
1076326468 10:129627183-129627205 ATGGGTGTGCTGGGGGATGAGGG + Intronic
1077489566 11:2854433-2854455 GTGTGTGTGTGTAGGGGTGTCGG - Intergenic
1077489570 11:2854465-2854487 GTGTGTGTGTGTAGGGTTGTAGG - Intergenic
1078506144 11:11947931-11947953 TTTTTTGTGCTTAGGGTTGATGG + Exonic
1078620475 11:12902619-12902641 GTGTGTGTGCTAAGGGATTGGGG + Intronic
1078733149 11:13994431-13994453 GTGTGTGTGTGTGGGGATGGGGG - Intronic
1078738058 11:14039428-14039450 GTATGTGTGTGTAGGGGTGAAGG + Intronic
1078897635 11:15611534-15611556 GTCTGTGTGCTCTGGGATGCAGG + Intergenic
1079361830 11:19776600-19776622 GTGTGTGTGGTTAGAGTTGTGGG + Intronic
1079361835 11:19776668-19776690 GTGTGTGTGGTTAGAGTTGTGGG + Intronic
1083154924 11:60816610-60816632 GTGTGTGGCCTTGGGGATGGAGG + Intergenic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083878066 11:65535129-65535151 ATGGGTGTGCTCTGGGATGAGGG + Intronic
1083900581 11:65641417-65641439 GTGTGTGAGCTCGGGGGTGAGGG + Exonic
1084531056 11:69728000-69728022 GTGTGTGTGCATATGGATGCGGG + Intergenic
1085294644 11:75424187-75424209 GTGTGTGTGTTGAGGGGTGAGGG - Intronic
1085643965 11:78210587-78210609 GGCTGTGTCCTTAGGGAAGAAGG - Exonic
1086851059 11:91809373-91809395 GTTTGTTTGCTTGGGGGTGATGG - Intergenic
1086897057 11:92325570-92325592 GTGTCTGTGCTTTGGAATGCAGG + Intergenic
1088042915 11:105410157-105410179 GTGTGTAGGCTTAGTGATGGGGG + Intergenic
1088440876 11:109868538-109868560 GTGTGTGTGTGTTGGGATAATGG - Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089092188 11:115887388-115887410 GTGTGTGTGCTTGGGGAAGGTGG + Intergenic
1089125767 11:116175488-116175510 CTGAGTTTCCTTAGGGATGAAGG - Intergenic
1089137607 11:116262339-116262361 ATGTGTGTGCCAAGGGCTGAAGG + Intergenic
1089186121 11:116615800-116615822 GTGTGTGTGTTTTGGGTTGGAGG - Intergenic
1089656206 11:119948683-119948705 GTCTGTGTGCTGATGGCTGATGG + Intergenic
1089807956 11:121108430-121108452 GTGTGTGTGCTTACTGAGGTGGG - Intronic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090761927 11:129845287-129845309 GTGTGTGTGTGTATGCATGAAGG + Intronic
1090761932 11:129845357-129845379 GTGTGTGTGTGTATGCATGAAGG + Intronic
1091072316 11:132579409-132579431 GTGTGTGTGATGAGGGAGGCTGG + Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091482936 12:853733-853755 ATGTATGTGCTTATGGAAGAAGG + Intronic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1091900355 12:4139688-4139710 GTGTGTGTGCATATGTGTGATGG - Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091915617 12:4270381-4270403 GTATGTGTGCTTAGTGCTGCAGG + Intergenic
1092008210 12:5087388-5087410 GTGTGTGTGGTTGGGGAGGGCGG + Intergenic
1092783885 12:12010731-12010753 GAGTGTGTGTTTAGGGAAGATGG - Intergenic
1092820735 12:12351033-12351055 GTGTGTGTGTTTATGGAGGTGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094016882 12:25874353-25874375 GTGTGTGAGGCTGGGGATGAAGG - Intergenic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1095122862 12:38439803-38439825 GTGTGTGGTCTGAGGTATGAAGG + Intergenic
1096071575 12:48778299-48778321 GTGTGTGTGTTTAGGGGGGCAGG - Intronic
1096429391 12:51530791-51530813 GTGTGTGTGCGGTGGGATGGGGG + Intergenic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096912469 12:54998109-54998131 GTGTGTGTGTGTTGGGATGTTGG - Intergenic
1097949900 12:65415993-65416015 GTGTGTGTGCTTGGGTAAGGTGG + Intronic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1099322715 12:81170867-81170889 GTGTGTGTGCGTGTGCATGAAGG + Intronic
1100304852 12:93340953-93340975 GTGTGTGTGTGTAGAGATGGGGG + Intergenic
1101345346 12:103880964-103880986 GTGTCAGTGCTTAGGGATGCGGG - Intergenic
1101451100 12:104780042-104780064 GTGTTTGTGTTTAGGGGTGTAGG - Intergenic
1101539072 12:105648065-105648087 GTGTGTGTGCTGCGGGTTGTGGG - Intergenic
1101674599 12:106906540-106906562 GTCTGTGTGGTTGGGGATGGTGG - Intergenic
1102045509 12:109827540-109827562 GTGTGTGTGTTTATGGAGGGTGG - Intronic
1102722522 12:115029808-115029830 GGGTGTGTACATAGGGGTGAGGG - Intergenic
1104287123 12:127433498-127433520 GTGTGTGTGTTTGGGGGTGGAGG - Intergenic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105610070 13:21960899-21960921 GTGTATGTGGTGAGGGATGTAGG - Intergenic
1105908763 13:24840535-24840557 GTGTGTGTGAATATGAATGATGG + Intronic
1106100483 13:26691434-26691456 GTGTGTGTGCTGGGTGATGGGGG - Intergenic
1106365310 13:29073537-29073559 GTGTGTGTGTTTGGGGGTGGGGG + Intronic
1106952061 13:34895221-34895243 CTAAATGTGCTTAGGGATGATGG + Intergenic
1107553803 13:41500190-41500212 GAGTGAGTGCTAATGGATGAAGG - Intergenic
1107761251 13:43681674-43681696 GTGTGTGTGTTTATGCATTATGG - Intronic
1107960384 13:45552345-45552367 GTGTGTGTGCTGAGGAAGCAGGG - Intronic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1109261707 13:60152327-60152349 TTCTGTGTGCTGAGGGATGTGGG - Intronic
1109698796 13:65997581-65997603 GTAATTGTGCTGAGGGATGAAGG - Intergenic
1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG + Intergenic
1110301177 13:73929012-73929034 GTGTGAGTTATGAGGGATGAAGG - Intronic
1110518539 13:76445917-76445939 GTGTGTGTGTTTAGTGGAGATGG - Intergenic
1110798678 13:79669986-79670008 GTGTGTGTGTTGGGGGATGGGGG - Intergenic
1111548061 13:89770026-89770048 CTGTGTGTGTTTGTGGATGATGG - Intergenic
1112080014 13:95959248-95959270 GTGTGTGTGTTTTGGGGTGGGGG + Intronic
1112209246 13:97358567-97358589 GTGTCTGTGGTTAGAGATGTCGG - Intronic
1113336082 13:109377215-109377237 GTGTGTCTGCTGAGGCAAGAGGG - Intergenic
1113597315 13:111542766-111542788 GTGTGTGTGTGTATGGATGAAGG + Intergenic
1114490982 14:23101819-23101841 GTGTGTGTGCTGAGTGGTTAGGG - Intergenic
1115213492 14:30991691-30991713 GAGTGTGTGTTTGGGGGTGAGGG + Intronic
1116738010 14:48719050-48719072 ATGTGGGTCCTTAGAGATGATGG - Intergenic
1117069882 14:52046948-52046970 GTGTGTGCACTTGGGTATGAAGG - Intronic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1118019656 14:61696961-61696983 GTGTGTGTGTTGGGGGATGGGGG - Intronic
1118125869 14:62903251-62903273 GTGTGTGTGGGTAGTGGTGAAGG - Intronic
1118185293 14:63531944-63531966 GTGTGTGTGTTTTGAGATGGAGG - Intronic
1118261435 14:64250841-64250863 GTGTGAGTGCTTCGGAATGCAGG - Intronic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1119098209 14:71854116-71854138 GTGTCTGAGCTGGGGGATGAGGG + Intergenic
1119687524 14:76644459-76644481 GTGTGTGTGCTTTGGCATTCAGG - Intergenic
1119729330 14:76940999-76941021 GTGTGTGTGTTTAGTAAAGATGG - Intergenic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1121113952 14:91330853-91330875 GTGTGTGGGCTAAGGGAAGGCGG + Intronic
1121232659 14:92369089-92369111 GTGGGTGGGCCTAGGGCTGACGG - Intronic
1121250081 14:92492947-92492969 GTGTGTGTGTTTGGGGTAGAGGG - Intronic
1121414675 14:93771162-93771184 GTGTGTGTGCATGTGGATGCAGG + Intronic
1122210175 14:100168395-100168417 GTGTGTGTGTTGAGGGTTGGGGG - Intergenic
1122210200 14:100168491-100168513 GTGTGTGTGTTGAGGGTTGGGGG - Intergenic
1123123861 14:105930480-105930502 CTGTGTTTCCTTGGGGATGAGGG + Intronic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124170377 15:27367301-27367323 GTGTGTTGGCCTAGGGATGAAGG - Intronic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1125440434 15:39696916-39696938 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1126110318 15:45171324-45171346 GTGTGTGTGTTCGGGGATGGGGG - Intronic
1128065815 15:64763798-64763820 GTGTGTGTGTGTAGGGGTGGGGG + Intronic
1128655019 15:69454201-69454223 GTGTGTGTGTTTAGTAGTGACGG + Intronic
1129913479 15:79247300-79247322 GAGTGTGTGCTCAGGGAAGGAGG - Intergenic
1130182297 15:81642861-81642883 GTGCGTGTGTGTAGGGAGGAGGG - Intergenic
1130573112 15:85066571-85066593 GTGTGTGTGTTTTGGGGGGATGG - Intronic
1130601923 15:85281441-85281463 GTGTGTGTGCATATGTATGTGGG - Intergenic
1130766986 15:86880733-86880755 GTGTGTGTGCATATGTATGTGGG + Intronic
1131888196 15:96943272-96943294 TTGTGTGTGTTTAGAGATGGGGG - Intergenic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133400016 16:5478896-5478918 GTATTTGGGTTTAGGGATGAGGG + Intergenic
1134135216 16:11672965-11672987 GTGTGTGTGTTTGGGGGTGGGGG - Intronic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1135170750 16:20181306-20181328 GTGTGTGTGTATAGGAAGGATGG - Intergenic
1135710525 16:24712949-24712971 GTGTGTGTGTATAGAGGTGAGGG + Intergenic
1135922574 16:26664263-26664285 GTGTGTGTCCATCTGGATGAGGG - Intergenic
1135987869 16:27197398-27197420 GTGTGTGTGGTGAGGGCTGCTGG - Intergenic
1136035979 16:27540798-27540820 GAGTGTGTGCACAGGGATTAGGG + Intronic
1136071953 16:27792637-27792659 GGGTGGGTGCTCTGGGATGAGGG - Intronic
1136137089 16:28262864-28262886 GTGTGTGTGTTTTGGGGTGGGGG + Intergenic
1136682554 16:31976582-31976604 GTGTGTGTGCGCAGGAGTGAGGG + Intergenic
1136782814 16:32917750-32917772 GTGTGTGTGCGCAGGAGTGAGGG + Intergenic
1137267745 16:46883210-46883232 GTGTGTGTGTGTTGGGATGTGGG + Intergenic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137625366 16:49904362-49904384 GTGTGTGGACTGAGAGATGAGGG - Intergenic
1139647867 16:68344923-68344945 GTGTGTGTGTGTAGAGATGCAGG - Intronic
1140383606 16:74513299-74513321 GGGTGTGGGCTAGGGGATGAAGG + Intronic
1140779305 16:78279892-78279914 GTGTGAGTGCATAGGGAAAAGGG + Intronic
1141085481 16:81092246-81092268 GTGTGTGTGCTGGGGGATAGTGG - Intronic
1141199686 16:81887671-81887693 GTGTGTGTGCTTAGATGGGAAGG - Intronic
1141364899 16:83433575-83433597 TTTTGTGAGCTTGGGGATGAGGG + Intronic
1141851656 16:86650246-86650268 GAGTGTGTTCTGGGGGATGAAGG + Intergenic
1142363739 16:89639139-89639161 GTGTGTGTGTGCAAGGATGAGGG - Intergenic
1203085464 16_KI270728v1_random:1181734-1181756 GTGTGTGTGCGCAGGAGTGAGGG + Intergenic
1142682600 17:1559137-1559159 GTGTGTGTTCTTAGGCTTCAAGG - Intronic
1146462459 17:33057021-33057043 GTGTGTGTGTTTAAGGAGGTGGG + Intronic
1146519656 17:33516418-33516440 GTGTGTGTGTGTATGGAGGAGGG + Intronic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1146756728 17:35439135-35439157 GTTTGTGTGCACAGGGAGGAAGG + Exonic
1146968338 17:37052108-37052130 GTGTGTGTGCTGGGGGGTGGGGG + Intronic
1147884060 17:43672798-43672820 GTGTGTGTTGTTAGGAATGCTGG - Intergenic
1148381787 17:47205036-47205058 CTCTGTGTGGTTAGAGATGAAGG + Intronic
1148663837 17:49360665-49360687 ATGTGTGTGCTTAGGGATTGAGG - Intronic
1148928176 17:51106092-51106114 GTGTGTGTGTGTAGAGATGGGGG - Intronic
1149002234 17:51769476-51769498 GTGTGTGTATTTGGGGGTGATGG + Intronic
1151572564 17:74934311-74934333 GTGTGTGTGTGTGGAGATGAGGG + Intergenic
1152043928 17:77923686-77923708 GGGTGTGTCCCTGGGGATGAGGG - Intergenic
1153802890 18:8686489-8686511 GTGTGTGTTCTTTGGGAGTAAGG - Intergenic
1156177498 18:34563971-34563993 GTGTGTGTGTGTAGTGAGGATGG + Intronic
1156600837 18:38604174-38604196 GTGTCTGTGTAAAGGGATGAGGG + Intergenic
1156960453 18:43022298-43022320 GTGTGAGTGGTTGGGGATCAGGG + Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158487392 18:57879672-57879694 GTGGGCATGCTTAGGGATGGTGG + Intergenic
1159750204 18:72291637-72291659 GTGTGTGTGTTTAAGGAAAATGG - Intergenic
1159867217 18:73720262-73720284 GTATGAGTGCTTTGGGTTGACGG - Intergenic
1159973409 18:74680600-74680622 GTATGTGTGGTTAGGAGTGATGG + Intronic
1160002981 18:75045100-75045122 GTGTGTGTGCTTGGGTGTGGGGG + Intronic
1160031694 18:75267366-75267388 GTGTGTGGGCTTAGTGGTAAGGG + Intronic
1160141828 18:76330689-76330711 GTGTGTGTATTTACAGATGAAGG - Intergenic
1160905607 19:1450339-1450361 GTGTGTGTCCTCGGGGAGGAGGG + Intronic
1161248594 19:3268736-3268758 GTGTGTGTGTTTAGTGGGGAGGG + Intronic
1161349521 19:3784297-3784319 GTGTGGGTGCTTGGGGCTGGGGG - Intronic
1161876168 19:6912221-6912243 GTGTGTGTGCTTATATATGTGGG - Intronic
1162015344 19:7843613-7843635 GTGTGTGTGAATAGGCATGAGGG + Intronic
1165693748 19:37884653-37884675 CTGTGTGGGCCTAGAGATGAAGG + Intergenic
1166199484 19:41227150-41227172 GTGTGTGTGCTGGGGGAGGGGGG + Intronic
1166340187 19:42132593-42132615 GTGTGTGTGCTGGGGGGTGGGGG + Intronic
1166722592 19:45005531-45005553 GTCTGTGAGTTTAGGGAGGATGG + Intronic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168231419 19:55034706-55034728 GTGTGTGTGTGTAAGAATGAGGG - Intronic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168365701 19:55785065-55785087 GTGTGTGTTCCATGGGATGAAGG - Intergenic
1168445174 19:56405454-56405476 GTGTGGGTGCTTGGAGATGCTGG + Intronic
1168450747 19:56464718-56464740 TTGTGTGTGTTTAGGGAGGGGGG - Intronic
1168466851 19:56609461-56609483 GTGTGGTTGCCTAGGGGTGAGGG - Intronic
1168682551 19:58326718-58326740 GTGTGAGGGCTGAGGGCTGAGGG - Intergenic
1202696712 1_KI270712v1_random:131643-131665 GTGTGTCTGGTTAGGGGTGGAGG - Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059228 2:878326-878348 GCGTGTGTGTGTAGGGGTGAGGG - Intergenic
925291199 2:2749763-2749785 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291219 2:2749836-2749858 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291233 2:2749888-2749910 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291253 2:2749961-2749983 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291267 2:2750013-2750035 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363505 2:3295654-3295676 GTGTGTGTGAGTAGAGAGGACGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363582 2:3296026-3296048 GTGTGTGTGAGTAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925957427 2:8981154-8981176 GAGTGGCTGCTTAGGGCTGAGGG + Intronic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926234382 2:11028378-11028400 GTGTGTGTGTCTATGGATGAGGG - Intergenic
927382458 2:22494866-22494888 GAGTTTGTGATTGGGGATGATGG + Intergenic
927735607 2:25518566-25518588 GTGTGTGTGTGTTGGGGTGAGGG - Intronic
928136555 2:28692307-28692329 GTGTGTGTGTCTAGGGTTGAGGG - Intergenic
928142301 2:28740272-28740294 GTGTGTGTGTGTAGTGCTGAAGG - Intergenic
928245804 2:29626086-29626108 GTGTGTGTGCTATGGACTGAAGG + Intronic
928302200 2:30135715-30135737 GTCAGTGTGCTTGGGGAAGATGG - Intergenic
929476632 2:42257126-42257148 GTGTGTGTGTTAGGGGATGGTGG + Intronic
929678680 2:43966285-43966307 GTGTGAGTGAAAAGGGATGATGG + Intronic
929783951 2:44975835-44975857 GTGTGTGTGCGTAGGGGTTGGGG - Intergenic
930370513 2:50495409-50495431 GTGTGTGTGTGTTGGGATGGGGG + Intronic
931183789 2:59930150-59930172 GTGTCTGTGAGTAGGGGTGAGGG + Intergenic
931253842 2:60554119-60554141 GTGGGTGTGCGTACGGAGGAGGG - Intergenic
931944351 2:67288414-67288436 GTGTCTGTGCTTGGGGAAGAAGG + Intergenic
931992589 2:67805690-67805712 GTGTGTGTGTTTGTGCATGAGGG - Intergenic
932417789 2:71584180-71584202 GTGTGTGTGAATGGGGGTGAAGG + Intronic
932439893 2:71727733-71727755 GTGGAGGGGCTTAGGGATGAGGG + Intergenic
932460047 2:71876202-71876224 GTGTGCGCCCTTAGGAATGAAGG + Intergenic
933242515 2:79938463-79938485 GTGTGTGTGCTTATGTGTGTTGG + Intronic
933289113 2:80417765-80417787 TTCAGTGTGCCTAGGGATGATGG + Intronic
934277865 2:91588657-91588679 GTGTGTCTGGTTAGGGGTGGAGG - Intergenic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
934949836 2:98568789-98568811 GTGTGTGTGTTTAGGGAGAAAGG - Intronic
935205707 2:100895097-100895119 GTGTGTGTGTGTACGCATGATGG - Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935591961 2:104852951-104852973 GTGTGTGTGATTAGCGGTGGGGG - Intergenic
936653312 2:114455178-114455200 GTGTGTGTGTTTGGGGGTGGTGG + Intronic
936771043 2:115913762-115913784 GTGTGTGTGTTTGAGAATGAGGG + Intergenic
936999332 2:118450344-118450366 GTGTGTGTGTTTGGGGGTGGGGG + Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937144051 2:119627159-119627181 GTGGTTGTGCCTAGGGAGGATGG - Intronic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937942956 2:127302428-127302450 GTGTGTGTGGTTAGAGTTGGAGG - Exonic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
939423838 2:142008579-142008601 GAGTTTGTGGTTAGGGATAATGG - Intronic
939721505 2:145658525-145658547 GTGTGTGTGTGTAGAGATGGGGG + Intergenic
939901792 2:147859360-147859382 CTGTGTGTGATTAGAGAGGAGGG + Intronic
939996820 2:148927502-148927524 GTGTGTGTGTATAGGGGGGATGG + Intronic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940486737 2:154305298-154305320 GTGTGTGTGTTCAGGAAGGAGGG + Intronic
941079517 2:161044451-161044473 GTATGTGTGCTTTTGGAAGATGG - Intergenic
941574399 2:167212900-167212922 GTGTGTGTGCAGAGGGGTGGGGG - Intronic
942609430 2:177727635-177727657 GTAAGTGTGCTTAGTGATGGTGG - Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943538014 2:189176673-189176695 GTGTGTGTGCATTGGGGTGGTGG - Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943803771 2:192095451-192095473 GTGTCTGTGCATGGAGATGAGGG - Intronic
944483580 2:200181004-200181026 GTCTGTGGGCTGAGGGCTGAAGG + Intergenic
944483646 2:200181384-200181406 GTGTGAGTGATTTGGGAGGAGGG - Intergenic
944863747 2:203840465-203840487 GTGTGTGTGTTGATGCATGAGGG + Intergenic
945243179 2:207695660-207695682 GTGTGTGTGCATGTGGATGTTGG - Intergenic
945549349 2:211200248-211200270 GTGTGTGTGTTAAGGGAATAGGG - Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
945812662 2:214567535-214567557 GTGTGTGTGTATGTGGATGAAGG - Intronic
946563219 2:220936444-220936466 GTGTGTGTGTTATGGGATGGAGG - Intergenic
948139143 2:235660078-235660100 CTGTGTGTGCTGAGGGGTGGGGG - Intronic
948775477 2:240286558-240286580 GTGCCTGTGCTTAGGGGTGAAGG + Intergenic
948829439 2:240591012-240591034 GTGCGTGTGCTGGGGGCTGAAGG + Intronic
1169132373 20:3173002-3173024 GTGTGTGTGCTCGGGGTGGAGGG - Intronic
1169775922 20:9253124-9253146 GTGTGTCTGATTGGAGATGATGG - Intronic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1170428409 20:16257761-16257783 GTGTGTGTGTTTTGGGGTGTGGG - Intergenic
1171263183 20:23750471-23750493 GGGAGCGTGCTTAGGCATGAAGG + Intronic
1171993217 20:31712776-31712798 GTGTGTGTGGCCAGGGAGGAGGG + Intronic
1172973316 20:38888864-38888886 GTGTGTGTGTTCAGGGATTCTGG - Intronic
1173107025 20:40146830-40146852 GTCTGTGTGCTGAAGAATGAAGG + Intergenic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173558413 20:43984428-43984450 GAGTATGTGTTTAGGGTTGATGG - Intronic
1174758548 20:53183574-53183596 GTGTGTGTGGTTGTGTATGAAGG - Intronic
1174798004 20:53538726-53538748 GTGTGTTTGCTTTGGGCAGAAGG + Intergenic
1174998562 20:55600357-55600379 GTGTGTGTGTTTCAGGTTGAGGG - Intergenic
1175297971 20:57922344-57922366 GTGTGTGTGCATAGGCATTGTGG - Intergenic
1175393100 20:58639666-58639688 GTGTGTGTGCGTTGGGGTGGGGG - Intergenic
1175925518 20:62469444-62469466 CTGTGTGTGCTAAGGGGTGATGG - Intronic
1176837846 21:13810292-13810314 GTGTGTGTGTGAAGGGATGTTGG + Intergenic
1176936317 21:14871768-14871790 GTGTGTGTGTTTTGGGATGCTGG + Intergenic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1179035440 21:37755555-37755577 CTGTGTGTGCTTTGCCATGAGGG + Intronic
1179560176 21:42210795-42210817 CTGTGTGTGCTTGGTGAAGAAGG + Intronic
1179675770 21:42981045-42981067 GTGTGTGTCCTTGGAGGTGAGGG + Intronic
1181041244 22:20193695-20193717 GGGAGGGTGCTGAGGGATGACGG - Intergenic
1181644954 22:24226112-24226134 GTGTCTGTGCTGGGGGAGGATGG - Exonic
1181762865 22:25069940-25069962 GTGTGTGTGTTTATGCATGAAGG - Intronic
1182012663 22:27013749-27013771 GTGTGTGTGTTGGGGAATGAGGG + Intergenic
1182299733 22:29330848-29330870 GAGGGTGTGCTTAGGGAAGCAGG - Intronic
1182413119 22:30203901-30203923 ATGTGTGTGCTTGTGTATGAGGG - Intergenic
1183173635 22:36205814-36205836 GTGTGTGTGCGTATGGGTGGGGG - Intergenic
1183477487 22:38043466-38043488 GTGTGTGTGCATAGGGGTAGTGG - Intergenic
1183501132 22:38180101-38180123 GTGTGTGTGCTGGGGGAAGTAGG - Intronic
1183526705 22:38327425-38327447 GTGTGTGATCTCAGGGGTGAAGG + Intronic
1184164172 22:42717670-42717692 GTGTGTGTGCTTTCTGATGAGGG - Intronic
1184505035 22:44895373-44895395 CTGTGTGACCTTACGGATGAGGG - Intronic
1184796255 22:46735064-46735086 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
1184960329 22:47923852-47923874 GTGTGTGTGCTTGGGGGTGTGGG - Intergenic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
949503866 3:4708064-4708086 TTGTCTGAGGTTAGGGATGAGGG + Intronic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
950503621 3:13379523-13379545 TTGTGTGTTCTTAGGCATGGCGG - Intronic
950638817 3:14334680-14334702 GTGTGTGTGTTGAGAGATAAAGG - Intergenic
950666947 3:14503489-14503511 GTGTGTGTGCAATGGGAGGAAGG - Intronic
950847367 3:16027825-16027847 TTGTGTCTGCTGAGGAATGAGGG - Intergenic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952593208 3:34982687-34982709 GTGTGTGGGGTAAGGGAAGAGGG - Intergenic
952601164 3:35084967-35084989 GTGTGTCTGCTACTGGATGATGG + Intergenic
953337988 3:42110309-42110331 GTGTGTGTGTTGAGGGGTGGGGG + Intronic
953502539 3:43451598-43451620 GTGGTGGTGGTTAGGGATGAAGG + Intronic
953756261 3:45648259-45648281 CAGTGGTTGCTTAGGGATGAGGG - Intronic
954439623 3:50514746-50514768 GTGTGTGTGTGTAGGGGTGGTGG - Intergenic
954496784 3:50972122-50972144 AGCTGTGTGCTTTGGGATGAGGG - Intronic
954764114 3:52898275-52898297 GTGTGTGTGCAGGGGGATGTTGG - Intergenic
955225997 3:57060811-57060833 GTGTGTGTGTTTCGGGGTGGGGG - Intronic
955710003 3:61768775-61768797 GTGTGTTTGCCCAGGGAAGAGGG + Intronic
956758689 3:72416767-72416789 GTGTGTGTCTTTGGGGTTGAAGG + Intronic
957379420 3:79406591-79406613 GTGTGTGTGTTTGGGGGTGTTGG + Intronic
957512333 3:81205315-81205337 GTATGTGTGTTTATGCATGATGG - Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
958459695 3:94379273-94379295 GTGTGTGTGGTTGGGGGTGGAGG + Intergenic
962642879 3:137406713-137406735 GTGTGTGTGTTTTGGGTTGGGGG + Intergenic
962740501 3:138359840-138359862 GTGTGTGTGCTCAAGAAGGATGG + Intronic
963466865 3:145693022-145693044 GTGTTTGTGCTTTGGGAGAATGG + Intergenic
963960883 3:151307577-151307599 GTGTGTGTGTTTAGAGCAGATGG + Intronic
964512716 3:157470628-157470650 GGCTGTGTGCTAAGGGGTGAGGG + Intronic
965419214 3:168436406-168436428 GTATGTGTGTTGAGGGAGGAAGG - Intergenic
965690892 3:171355887-171355909 GTTTGTGTGTTTGGGGTTGAGGG - Intronic
966041829 3:175500448-175500470 GTTTGTTTGCTTAGGGAACAAGG + Intronic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
967089758 3:186125563-186125585 GTGTGTGTGTGTAGTGGTGATGG + Intronic
967089897 3:186126446-186126468 GTGTGTGTGTGTAGTGGTGATGG + Intronic
967089920 3:186126577-186126599 GTGTGTGTGTGTAGTGGTGATGG + Intronic
967191453 3:186988548-186988570 GTGTGTGTGTTTTGGGGTGGGGG + Intronic
968886260 4:3335432-3335454 GAGGGTGGGCTTAGGGCTGAGGG - Intronic
969032878 4:4227678-4227700 GTGTGTCTGGTTAGGGGTGGAGG + Intergenic
969066444 4:4485657-4485679 GTGTGTGAGCTCTGGGGTGAGGG - Intronic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
970354128 4:15235569-15235591 GTGTGTGTGTTTAGGGTCGAAGG - Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971820061 4:31540033-31540055 GTGTGTGTTTTTTGGGGTGAGGG - Intergenic
972739870 4:41879110-41879132 TTGTGAGTGCTTAAGGCTGAAGG + Intergenic
972891549 4:43562482-43562504 GTGTGTGTGCGTGGTGATGTTGG - Intergenic
974113199 4:57549253-57549275 GTGTGTGTGCTTAAGGGCAAAGG + Intergenic
974214167 4:58823512-58823534 GTGTGTGTGTGTGTGGATGAAGG - Intergenic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
976114261 4:81710204-81710226 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
976409562 4:84698027-84698049 GTGTGTGTGGTTGAGGAGGAAGG - Intronic
977227131 4:94405988-94406010 GTGTGTGTGATGGGGGAGGATGG - Intergenic
977862536 4:101981957-101981979 GTGTGTGTGGGTAGGGATTGTGG + Intronic
977870022 4:102080494-102080516 GTGTGTGGCCTTAGGACTGAGGG + Intergenic
977900201 4:102413759-102413781 GTGTGTGTGTATTGGGGTGAGGG - Intronic
979765321 4:124458727-124458749 GTGTGTGTGTTTATGAATAAAGG - Intergenic
980110437 4:128631131-128631153 GTGTGTGTGCGTGGGCACGAAGG + Intergenic
981065520 4:140480716-140480738 GTGTGTGTGTTTAGAGATGAGGG - Intronic
981460985 4:145013790-145013812 GAGTGTGTGCTTGGGGGTGGAGG - Intronic
981698296 4:147580980-147581002 GTGTGTGTGTTTTGGGAGGTGGG - Intergenic
981955732 4:150470830-150470852 GTGTGTGTGTGTAGTAATGAGGG - Intronic
982230376 4:153203384-153203406 GTGTGTGTGTGTAGAGATGTGGG - Intronic
982236962 4:153260653-153260675 GTGTGTGTGTTTTGGGGGGAAGG - Intronic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982998759 4:162384903-162384925 GTATGTGTGCTTGGGGGTGTTGG + Intergenic
983224306 4:165071885-165071907 GTGTGTGTGCATGGGGCTGGGGG + Intergenic
983330040 4:166314741-166314763 GTGTGTGTGCTTGAGAGTGAGGG + Intergenic
983871912 4:172833073-172833095 GTGTGTGCGCTTGGGGGTGGGGG + Intronic
984084541 4:175292542-175292564 GTGTGTGTGTGTCGGGATGGGGG + Intergenic
984088371 4:175340095-175340117 GTGGGTGGTCTTAGGGATGATGG + Intergenic
984186783 4:176554090-176554112 TGGTGTGTGCTAAGGGTTGAGGG + Intergenic
984405865 4:179328984-179329006 GTGTGTGTGTGTTGGGATGTGGG - Intergenic
984713140 4:182902732-182902754 GTGTGTGGGCTGCGGGATGGAGG + Intronic
985025228 4:185733548-185733570 AGGTGTGTGCTTGGGGATAAGGG + Intronic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
987059665 5:14230366-14230388 GTGTGTGTGTTGGGTGATGAGGG + Intronic
989791646 5:45411140-45411162 GTGTGTGTACATTGGGGTGAGGG + Intronic
991326194 5:65436209-65436231 GTGTGTGTGTGTAGAGATGGGGG - Intronic
991547878 5:67803630-67803652 GTGTGTGTGCTTGTTTATGAGGG - Intergenic
991978297 5:72204612-72204634 ATGTGTGTGGTTGGGGATGGAGG - Intronic
991982106 5:72243002-72243024 ATGTGTGTGTTTAGGGCTGGTGG - Intronic
992443459 5:76814455-76814477 GTGTGTGTGGATGGGGAAGAGGG + Intergenic
994023638 5:95056852-95056874 GTGTGTGTGTATTGGGATGAAGG - Intronic
994957872 5:106557989-106558011 GTGTGTGTGTCAAGGGTTGAAGG - Intergenic
995226043 5:109702351-109702373 GTCTGTGTGTGTAGGGAGGATGG + Intronic
995337636 5:111019306-111019328 GTGTGTGTGTTGGGGGATGTGGG - Intergenic
995870610 5:116739917-116739939 GTGTGTGTGCCAGGGGAAGAGGG + Intergenic
995871765 5:116750579-116750601 GTGTGTGTGTTTTGGGGTGGGGG - Intergenic
996336090 5:122385701-122385723 GTGTGTGTGTGTAGGGGTGCAGG + Intronic
996685639 5:126277528-126277550 GTGTGTAAGTTTAGAGATGAGGG + Intergenic
996803897 5:127433378-127433400 GCGTGTGTGCTGAGGGACGCTGG + Exonic
996909864 5:128643446-128643468 GTGTGTGTGCGTGGGGCTGGGGG + Intronic
997500698 5:134371377-134371399 GTGTGAGTGCTGGGGGAGGAGGG - Exonic
997758176 5:136420058-136420080 GTGTGTGTGCATGGGGAAGTGGG + Intergenic
997904241 5:137799088-137799110 TTGGGTGTGCTTAGGAATTAAGG - Intergenic
999408666 5:151330007-151330029 GTGTGTGTGTTTAGGGGGGTGGG + Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000951248 5:167485930-167485952 GTGTGTGTGCACATAGATGAAGG - Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001687037 5:173601242-173601264 TTGTTTGTACTTGGGGATGATGG + Intergenic
1001708757 5:173761231-173761253 GAGGGGGTGCCTAGGGATGAGGG - Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1003499927 6:6695559-6695581 GAGTGTGGGCTGAGGGATGGTGG + Intergenic
1003655481 6:8003208-8003230 GTGTGTGTGTCTAGTGGTGATGG + Intronic
1004048120 6:12046266-12046288 GTCTGTGTTATTAGGGATAATGG + Intronic
1004481148 6:16020401-16020423 GTGTGTGTGTCTAGGTGTGAAGG - Intergenic
1004672320 6:17809253-17809275 TTGTGTGTGCTGAGGGAGGGTGG + Intronic
1006296326 6:33171652-33171674 GTCTGTGAGCCTAGGGTTGATGG - Intronic
1006638622 6:35477217-35477239 GTGTGTTTGCTTTGGGAGGGAGG - Intronic
1006795713 6:36731130-36731152 GTGTGTGTGTGTAGGGGTGGGGG - Intronic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1007446688 6:41911990-41912012 GTGTGTGCGCTTAATGAAGAAGG + Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011241606 6:85277409-85277431 GTGTGTATGTATAGGGATGGAGG + Intergenic
1012208330 6:96489320-96489342 GTGTGTGTGATGAGTGAGGAAGG - Intergenic
1012617779 6:101298669-101298691 GTGTGTGTGTATAGGGAGGTGGG + Intergenic
1012857847 6:104524217-104524239 ATGTGTATGGTTAGGGATTATGG + Intergenic
1014120398 6:117718915-117718937 GTGTGTGTGTGAAGGGATGGGGG + Intergenic
1014293929 6:119594700-119594722 GTGTATGTATTTAGGGAGGAGGG - Intergenic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015560901 6:134514869-134514891 GTGTGTGTGAGTAGGAGTGAGGG + Intergenic
1016320892 6:142844760-142844782 GTGTGTGTGCATTGGATTGACGG - Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017032505 6:150236643-150236665 GTGTGTGTGTTTAGCCAGGAGGG + Intronic
1017362662 6:153594453-153594475 GTGTGTGTGTTTAGGGCAGTAGG - Intergenic
1017406950 6:154129839-154129861 GTGTGTGTGCTGGGGGGGGAGGG - Intronic
1017482445 6:154871149-154871171 GTGTGTGTGTTTTGGGGTGGGGG - Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1017878598 6:158544207-158544229 GTGTGTGTGTGTTGGGGTGAGGG + Intronic
1017878644 6:158544478-158544500 GTGTGTGTGCTGGGGTATCACGG + Intronic
1018049482 6:159996769-159996791 ATGTGTGTGCTTTGGGTTGAGGG - Intronic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018186814 6:161272693-161272715 GTGTGTGTGTTTAGGGAAATGGG - Intronic
1018212869 6:161498929-161498951 GTGTGTGTGTATGGGGATGGGGG + Intronic
1018859593 6:167701205-167701227 GTGTGTGTGTTTTGGGAGAAAGG - Intergenic
1019190722 6:170249192-170249214 GTGTGTGTAGTTAAAGATGAGGG - Intergenic
1021500095 7:21323129-21323151 GTGTGTGTGCGTGGGGTTGGAGG - Intergenic
1021917720 7:25452345-25452367 GTGTGTGTGGTTGGGGGTGGTGG - Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1024337072 7:48219871-48219893 GTGTGTGTGTTTGGGGAAGGTGG - Intronic
1024352725 7:48383349-48383371 GTGTGTGTGCATATGTATGTGGG + Intronic
1024760200 7:52586980-52587002 GTGTGAGAGGTTAGGGAAGATGG + Intergenic
1024866700 7:53911546-53911568 GTGTGTGTGCATGTGGATGGGGG - Intergenic
1025035404 7:55590205-55590227 GTCTGTGGGCTGAGGGGTGATGG + Intergenic
1026390697 7:69898648-69898670 CTGTGTGTGGTTGGGGATGAGGG - Intronic
1026771922 7:73207583-73207605 GTGTGTGGGCTCAGGCAGGAGGG - Intergenic
1027012790 7:74760979-74761001 GTGTGTGGGCTCAGGCAGGAGGG - Intergenic
1027075250 7:75185074-75185096 GTGTGTGGGCTCAGGCAGGAGGG + Intergenic
1027820582 7:83038394-83038416 TAGTGGTTGCTTAGGGATGAAGG - Intronic
1028849469 7:95520644-95520666 GTGTGTGTGGATGGGGATGGGGG - Intronic
1029035514 7:97516481-97516503 GTGTGTGTGTTTTGGGAGAATGG + Intergenic
1029440354 7:100583822-100583844 GTGTGTGTGCATGTGGACGAAGG + Intronic
1029495204 7:100892790-100892812 GTGGGTGTGGTGAAGGATGAGGG - Exonic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030607430 7:111652574-111652596 GTGTGTGTGTGTTAGGATGAAGG - Intergenic
1030668622 7:112309514-112309536 GAGGGTGTGCTTTGGGATGAGGG + Intronic
1030670149 7:112326367-112326389 GTGTGTGTGTTTTGGGGTGGGGG - Intronic
1030973799 7:116095333-116095355 GTGTGTGTGTTTAGGGGTACAGG + Intronic
1031206962 7:118772233-118772255 ATCTTTGTGCTTAGGGATGCAGG - Intergenic
1031963579 7:128011103-128011125 GTGTGTGTGTTTGGGGGTGGGGG - Intronic
1033614132 7:142995488-142995510 GTGTATGTGATGAGGGATAATGG - Intergenic
1034895517 7:154873961-154873983 ATGTGTGTGCTTATGTATGCAGG - Intronic
1034911248 7:155000804-155000826 GCGTATGTGCTGAGGAATGAAGG - Intronic
1035205122 7:157289975-157289997 GTGTGTGTGTTTGGGGGTGGGGG + Intergenic
1035268295 7:157704491-157704513 GTGTGTGTGCTTGGGAATGGAGG + Intronic
1037118425 8:15253941-15253963 GTGTGTGTGTGAAGGGATGGGGG - Intergenic
1037764983 8:21767205-21767227 GTGTGTGTGTTTGGGCATGGTGG - Intronic
1039206466 8:35161140-35161162 GTGTGTTTGCTTTTGGATGGAGG - Intergenic
1039235873 8:35502251-35502273 GTGGGTGAACTTAGAGATGAGGG + Intronic
1039596328 8:38793020-38793042 GTGTGTGTGTTTGGGGAAGGGGG - Intronic
1039733347 8:40303848-40303870 GTGTGTTTTCCTGGGGATGAAGG + Intergenic
1039752464 8:40490996-40491018 GTGTGTGTGTGTAGAGATGGGGG + Intergenic
1039864213 8:41487282-41487304 ATGAGTGTGTTTAGGGATGAGGG + Intergenic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1040410713 8:47151763-47151785 GTGTGTGTGGCTAGGAATGGTGG - Intergenic
1040505835 8:48046771-48046793 GTGTGTGTGTGTAGAGATGGGGG + Intronic
1041015877 8:53592868-53592890 GTGTGTGTGTTGGGGGGTGAGGG - Intergenic
1041242841 8:55863018-55863040 GAGTGTGTGTTTAGGGGTGTAGG - Intergenic
1042530454 8:69809746-69809768 GTGTGTGTGTTTTGTGAGGAGGG + Intronic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043126543 8:76403684-76403706 GTGTGTGTGCATATGTATGTGGG - Intergenic
1043557397 8:81447747-81447769 GTGTGTGTGTTTAGGCATGTCGG + Intergenic
1043842207 8:85120620-85120642 TTGTGGTTGCTTAGGGTTGAGGG - Intronic
1043854631 8:85250956-85250978 GTGTGTGTGGTGGTGGATGAAGG + Intronic
1044865938 8:96571341-96571363 GTGTGTATGCTTAGGGAGGTGGG + Intronic
1045039742 8:98211756-98211778 GTGTGTGTGTGTAGGGGTGGGGG + Intronic
1045743532 8:105389048-105389070 GTGTGTGTGTGTAGGCATGAGGG + Intronic
1046040705 8:108900289-108900311 ATGAGTGAGCTTAGTGATGAAGG + Intergenic
1046768392 8:118094984-118095006 GTATGTTTGCTCAGGGAGGAGGG - Intronic
1046942938 8:119948718-119948740 TAATGTTTGCTTAGGGATGAGGG - Intronic
1047039179 8:120973918-120973940 GTGTGTGTGTTTGGGGGTGGAGG + Intergenic
1047343858 8:124008301-124008323 GTGTGTGTGCGTATATATGATGG - Intronic
1047761921 8:127960926-127960948 GTGTGTGTGTTTGGGGGTGGGGG + Intergenic
1047792940 8:128223471-128223493 TTGTGGGTGATTAAGGATGATGG - Intergenic
1048259440 8:132933456-132933478 GTGTGTGTGTTTGGGCATGTGGG + Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049439951 8:142604754-142604776 GTGTCTGTAATTAGGGGTGAGGG + Intergenic
1049521248 8:143092520-143092542 GAATGTGTGCTCAGGGTTGAGGG + Intergenic
1049569862 8:143364338-143364360 CTGAGTGTGCTTAGGGAGGGAGG - Intergenic
1049596558 8:143486758-143486780 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596595 8:143486988-143487010 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596649 8:143487310-143487332 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596656 8:143487356-143487378 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596679 8:143487494-143487516 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596686 8:143487540-143487562 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596707 8:143487678-143487700 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596735 8:143487862-143487884 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596742 8:143487908-143487930 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596762 8:143488046-143488068 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596769 8:143488092-143488114 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596776 8:143488138-143488160 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596783 8:143488184-143488206 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596803 8:143488322-143488344 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596810 8:143488368-143488390 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049596817 8:143488414-143488436 GTGTGTGAGCTTCGTGGTGATGG - Intronic
1049736422 8:144209065-144209087 GTGTGTGTGTTTAGTGGAGACGG + Intronic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1050601655 9:7258887-7258909 GTGTGTGTGTTTAGGGGGAAGGG + Intergenic
1051384848 9:16496556-16496578 ATGTCTGTTCTTAGGCATGAAGG - Intronic
1052042545 9:23755724-23755746 GTGTGTGTTCTTAGGTCTGTAGG - Intronic
1053594125 9:39542940-39542962 GTGTGTGTGTTTTGGGAGTATGG - Intergenic
1053851908 9:42297986-42298008 GTGTGTGTGTTTTGGGAGTACGG - Intergenic
1054572128 9:66822017-66822039 GTGTGTGTGTTTTGGGAGTACGG + Intergenic
1054762130 9:69013130-69013152 GCCTGTGTACTTCGGGATGAAGG + Exonic
1054888491 9:70225402-70225424 GTGTGGGTGCTGGGGGATGCTGG + Intronic
1055651058 9:78407538-78407560 ATGAATGTGCGTAGGGATGAGGG + Intergenic
1057355553 9:94328423-94328445 GAGTCTGTGGTTAGGGAGGAGGG - Intronic
1057440066 9:95076730-95076752 GTCTCTGGGCATAGGGATGAGGG + Intronic
1057652203 9:96929199-96929221 GAGTCTGTGGTTAGGGAGGAGGG + Intronic
1057662436 9:97014876-97014898 GTGTGTGTGTTTGGGGGTGGTGG - Intergenic
1058421303 9:104835707-104835729 GTGTGTATGCTTGGAAATGAGGG - Intronic
1061520346 9:131114018-131114040 GTGTGTGAGGTTTGGGGTGATGG + Intronic
1061520471 9:131114631-131114653 TTGAGTGTGTTTAGGGAGGAGGG + Intronic
1062118997 9:134824019-134824041 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1062183212 9:135202339-135202361 GTGTGGGTGAGTAAGGATGAGGG - Intergenic
1062205979 9:135337628-135337650 GTGTGTGTGCATATGTTTGAGGG + Intergenic
1185845868 X:3437692-3437714 GTGTGTGTGCCTGGGCATGTTGG + Intergenic
1185845883 X:3437935-3437957 GTGTGTGTGCCTGGGCATGTTGG + Intergenic
1185845888 X:3438025-3438047 GTGTGTGTGCCTGGGCATGTTGG + Intergenic
1185888097 X:3800875-3800897 TTGTGGTTGCTTAGGGATGGGGG - Intergenic
1186672280 X:11780040-11780062 GTGTGTGTGTGTAGAGATGAGGG - Intergenic
1187122342 X:16421626-16421648 GGGTGTGTGTTCAGGGATGCAGG - Intergenic
1187470223 X:19563088-19563110 GGGTTTGTGCTTAGTTATGAGGG - Intronic
1187797954 X:23024923-23024945 GTGTGTGTGTGTAGAGATGGGGG - Intergenic
1187969612 X:24646730-24646752 GTTTTTGTGCTTCGGGAGGAGGG - Intronic
1188728784 X:33619782-33619804 GTTTGTTTGCTGAAGGATGAGGG + Intergenic
1188919034 X:35948807-35948829 GTGTGTGTGTGTAGGGGTGGTGG + Intronic
1189646686 X:43140395-43140417 GTGTGTGTCTTTAGGGTGGAAGG - Intergenic
1189918938 X:45884558-45884580 GTGTCTGTGCTTTTGGAGGAGGG + Intergenic
1190454760 X:50616860-50616882 GTGTGTGTGGTGAGGGATGGGGG - Intronic
1191735921 X:64387664-64387686 GTGTGTGGGGTTGGGGGTGAGGG + Intronic
1192423483 X:71054424-71054446 GTGTGTGTGTGTAGAGATGGGGG - Intergenic
1193224578 X:78967008-78967030 ATGTGTGTACTTATGGCTGAGGG - Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1194319558 X:92427199-92427221 GTGCATGTGCATAGGCATGAAGG - Intronic
1194539854 X:95156763-95156785 GTGGGTGTGCTCAGCCATGAGGG - Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1195716249 X:107821151-107821173 GCGTGTGTGGGTGGGGATGATGG - Intergenic
1195771996 X:108361220-108361242 TTGTGACTGCTAAGGGATGAAGG - Intronic
1195966048 X:110431351-110431373 GTGTGCTGGCTGAGGGATGAAGG + Intronic
1196164933 X:112528451-112528473 GTGTGTGTGTGTTGGGATAAGGG - Intergenic
1197053031 X:122083730-122083752 GTGTGTGTGCTTATGTGTGGTGG - Intergenic
1197618188 X:128717836-128717858 GTGTGTGTGGTTACGGCTGGTGG + Intergenic
1197891093 X:131271313-131271335 GTGTGTGAGCCCAAGGATGAGGG + Intergenic
1197948025 X:131861803-131861825 GTGTGTGTGTCTACCGATGAAGG - Intergenic
1198009172 X:132533147-132533169 GTATGTTTGCTTTGGGAGGAGGG + Intergenic
1198034033 X:132783524-132783546 GTGTGGGTGGGTAGAGATGAAGG - Intronic
1198496117 X:137195282-137195304 GTGTGTGTGTATACGGATGAGGG + Intergenic
1198823352 X:140673069-140673091 GTGTGTGTGGTTGGGGGTGGTGG + Intergenic
1198986378 X:142458867-142458889 GTGTGTGTGGTGGGGGATGTGGG - Intergenic
1199965732 X:152819107-152819129 GTGTGTGTGTTTGGGGGTGGGGG - Intergenic
1200334544 X:155335605-155335627 GTGAGTGTTCTTCTGGATGAGGG + Intergenic
1200627682 Y:5540275-5540297 GTGCATGTGCATAGGCATGAAGG - Intronic
1200806205 Y:7436167-7436189 GTGAGTGGGGTGAGGGATGAAGG - Intergenic
1201426125 Y:13852460-13852482 GTGTGTGTTTTTTGGGAGGAAGG - Intergenic