ID: 966050250

View in Genome Browser
Species Human (GRCh38)
Location 3:175607847-175607869
Sequence CAGCTAGGAATGAGAAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966050248_966050250 -5 Left 966050248 3:175607829-175607851 CCAAGTGATTCTAATGAGCAGCT 0: 1
1: 10
2: 77
3: 339
4: 1026
Right 966050250 3:175607847-175607869 CAGCTAGGAATGAGAAACAATGG 0: 1
1: 0
2: 4
3: 26
4: 358
966050247_966050250 9 Left 966050247 3:175607815-175607837 CCGTGAGTTTTAATCCAAGTGAT 0: 1
1: 0
2: 3
3: 20
4: 181
Right 966050250 3:175607847-175607869 CAGCTAGGAATGAGAAACAATGG 0: 1
1: 0
2: 4
3: 26
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966050250 Original CRISPR CAGCTAGGAATGAGAAACAA TGG Intronic
902945944 1:19838669-19838691 CAGTTAGGAAAAAGAAAAAAAGG + Intergenic
905260689 1:36716058-36716080 CAGCCAGGATTGAGAAACCCTGG - Intergenic
905941771 1:41868686-41868708 CAGCAAGGAAAGAGAAAGCATGG + Intronic
906175636 1:43769578-43769600 AAGGTAGGAAAGAGAAGCAAAGG + Intronic
906857632 1:49325546-49325568 CAGGAAGGAATGAGAAGCAATGG - Intronic
907796549 1:57724049-57724071 TAGCTATGAATCAGAGACAAGGG + Intronic
908912922 1:69093612-69093634 CATCTATGAATGACAAAGAATGG - Intergenic
908912926 1:69093656-69093678 CATCTATGAATGACAAAGAATGG - Intergenic
909835881 1:80254000-80254022 AAACTAGGAAGTAGAAACAATGG + Intergenic
910762640 1:90749625-90749647 CAACGAGGAAGGAAAAACAATGG - Intergenic
910858600 1:91720659-91720681 CACCTAAGACTGAGAACCAATGG + Intronic
914384505 1:147154814-147154836 CAGCCAGGGATGAGAATCATTGG + Intergenic
915340706 1:155175191-155175213 CAGCGGGGAAAGAGAAGCAAGGG + Intronic
915601760 1:156927090-156927112 CAGCTAGGAAGTAGAGTCAAAGG - Intronic
916990068 1:170233514-170233536 CTCCTAGGTATGAGGAACAATGG - Intergenic
919480671 1:198085050-198085072 CAGCTGGGAATGAGAACCATTGG - Intergenic
920306596 1:205022200-205022222 CAGTTGGGAATCAGAAAAAAAGG - Exonic
920720644 1:208383554-208383576 CAGCTAGGAAGGAAAACCAAAGG + Intergenic
921139371 1:212291523-212291545 CAGCCAGGATTGAGAATCACCGG + Intronic
921377908 1:214493067-214493089 CACTTAGGAATTAGAAACACTGG - Intronic
921384955 1:214559244-214559266 CAGTTAGGAATAGGAAATAAAGG - Intergenic
1062973783 10:1668322-1668344 CCTCTAGGAATGAGGCACAAAGG + Intronic
1064433873 10:15293927-15293949 TAGCTAAGAAGGAGAAAAAATGG + Intronic
1064447332 10:15407346-15407368 AAGCTAGGAATGAGAGGCCAGGG + Intergenic
1065645540 10:27830241-27830263 CAGGTAGGAGTGAGCAGCAAGGG - Intronic
1066475352 10:35741534-35741556 CAGGTAGGAATTAGAAGGAAGGG + Intergenic
1067113904 10:43420345-43420367 CCGCGAAAAATGAGAAACAAGGG + Intergenic
1067206859 10:44225197-44225219 TAGATAGGAATAAGAAAGAATGG + Intergenic
1067262031 10:44701206-44701228 CAACTAGTGATGATAAACAAGGG - Intergenic
1067879424 10:50030507-50030529 CTGTTGGGAATGAGAAGCAATGG + Intergenic
1067892471 10:50148926-50148948 CTGTTGGGAATGAGAAGCAATGG - Intergenic
1067980848 10:51082825-51082847 CAGCTATGTTTGAGAACCAATGG - Intronic
1069526060 10:69173221-69173243 CAGCCAGGGTTGAGAACCAATGG - Intergenic
1069931821 10:71887988-71888010 CAGCCAGGATTGAGAAACACTGG - Intergenic
1071846759 10:89528717-89528739 CAGCCAGGGTTGAGAAACTATGG - Intronic
1074228976 10:111514937-111514959 CAGCTAGGTTTGAGAATCACCGG - Intergenic
1074877162 10:117622414-117622436 CAGCCAGGGCTGAGAAACACTGG - Intergenic
1074935392 10:118174087-118174109 CAACTTGGAATGAGAAAGTAAGG - Intergenic
1075838670 10:125478020-125478042 GAGCTGGGTTTGAGAAACAATGG + Intergenic
1077003852 11:341174-341196 AAGGAAGGAATGAGAAAGAAAGG + Intergenic
1077853718 11:6100568-6100590 CAGGGAGGAAGGAGAAAAAAAGG - Intergenic
1078718670 11:13863171-13863193 GAGGTAGGAATGACAAAGAATGG + Intergenic
1079445407 11:20552410-20552432 CAGCTAGTAATTAGCAACATTGG - Intergenic
1079507307 11:21167796-21167818 GAGCTAGCCATGTGAAACAATGG - Intronic
1079746889 11:24143762-24143784 CAGGTATGAATGGAAAACAAAGG - Intergenic
1081825935 11:46051783-46051805 AAGCTAAGAAGCAGAAACAAAGG + Intronic
1084868013 11:72075606-72075628 CATCCAGGACTGAAAAACAAAGG - Intronic
1085128827 11:74020247-74020269 AAGATAGGAATTAGAAGCAAAGG - Intronic
1085159465 11:74327474-74327496 AATCTGGAAATGAGAAACAAGGG - Intergenic
1087609620 11:100418336-100418358 CACCTAGGAATAAGCAACACTGG + Intergenic
1088220479 11:107565489-107565511 CAGCTAGGGCTGAGAACCTAGGG - Intronic
1089541076 11:119189250-119189272 CAGGGAGGAGTGAGAAAGAAGGG + Intronic
1090165812 11:124545759-124545781 CAGCTAGGTTTGGGAAACACTGG - Intergenic
1092037551 12:5350415-5350437 CAGCCAGAAATGAGAAATTAGGG - Intergenic
1092990563 12:13893783-13893805 CAGCCAAGAATGAGCAAAAAAGG + Intronic
1095659135 12:44708731-44708753 CAGCTAGGATTGTGAACCACTGG - Intronic
1095862127 12:46929191-46929213 CAGCCAGGATTGAGAAGCACTGG + Intergenic
1097347727 12:58513152-58513174 CAGGTTGGTATGAGGAACAACGG - Intergenic
1100922020 12:99498926-99498948 TAGCTAGGTATGAGTCACAAGGG + Intronic
1101661635 12:106770987-106771009 CAGCTAGTATTGAGAACCACTGG - Intronic
1102770281 12:115470319-115470341 CAGCTTGGCAGGGGAAACAAAGG + Intergenic
1103183633 12:118936835-118936857 CAGCTAGGTATGGGAATCACTGG - Intergenic
1103696784 12:122822014-122822036 AAGCCAGGAATGGGCAACAATGG + Intronic
1103705761 12:122871225-122871247 CAGCTCCAAATGAGAAACCAAGG - Intronic
1103879122 12:124152539-124152561 CTGCCAGGAATGTGAAACCATGG - Intronic
1105981871 13:25525534-25525556 CAACTATGAAGGAGAAATAAAGG - Intronic
1106281410 13:28276072-28276094 CAGCCAGGATTGAGAACCACTGG - Intronic
1107460490 13:40597458-40597480 CAGCTCGGACTGATAAAAAAGGG - Intronic
1107754261 13:43601962-43601984 CAAATAGGAAGGAGAAATAAAGG + Intronic
1108346570 13:49552233-49552255 CAGCTGGGCCTGGGAAACAATGG - Exonic
1108442575 13:50470771-50470793 AAACTAGGAATGAGAGACAATGG + Intronic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1109031666 13:57198480-57198502 CAACTATGAAGGTGAAACAAAGG - Intergenic
1109245565 13:59950535-59950557 GAGCTATGAATGAAAAATAAAGG + Intronic
1109339802 13:61041570-61041592 CATCTCTGAATGAGAAACATAGG + Intergenic
1110164471 13:72422682-72422704 CAGATGGGAATGAGAGACACTGG - Intergenic
1110516521 13:76419184-76419206 AAGCTAAGAATGAGATAAAATGG - Intergenic
1110578081 13:77083670-77083692 CAGCTAGGAAAGAGAAGTAGGGG + Intronic
1112029378 13:95443246-95443268 CAGCTAAGAAAGGGAAACAAGGG - Intronic
1114244230 14:20897743-20897765 CAGCTAATAATGAGAAAGAAAGG + Intergenic
1114247265 14:20926245-20926267 CAGCTAATAATGAGAAAGGAAGG + Intergenic
1114522765 14:23349222-23349244 CAGGTAGGCATGAGACCCAAGGG + Intronic
1115228674 14:31133627-31133649 CACCAAAGGATGAGAAACAAGGG - Exonic
1116149015 14:41114096-41114118 CAGATAGGAAGAAGGAACAAAGG + Intergenic
1117325798 14:54667944-54667966 CAGGAAGGCATGAGAAACAGAGG - Intronic
1118491281 14:66263224-66263246 CACCAAAGAATGAGAAACAAGGG - Intergenic
1118513237 14:66499368-66499390 CAGCTAGGATTGAGTATCAGTGG - Intergenic
1118909092 14:70046422-70046444 AACCCAGGAATGAGAGACAAGGG + Intronic
1118926246 14:70192349-70192371 CAGCTAGATATAAGTAACAATGG - Intergenic
1119443800 14:74647422-74647444 CAGCTACAAATGAAAAACCACGG + Intergenic
1119607261 14:76031121-76031143 CACCTAGGATATAGAAACAAAGG - Intronic
1120009421 14:79396574-79396596 CAGGTAGGAATGAGGAAGGAAGG + Intronic
1120096479 14:80394490-80394512 CATCTATTATTGAGAAACAAAGG - Intergenic
1120842559 14:89098490-89098512 CAGCCAAGGATGAGAAACACTGG + Intergenic
1125326339 15:38539450-38539472 CAGCTAGGAAGTAGCAAGAAGGG + Intronic
1125350319 15:38760018-38760040 CAGCCAGGATTGAGAATCACTGG - Intergenic
1125975609 15:43948929-43948951 CAAATAGGAAAGAGAAACTAAGG - Intronic
1126235742 15:46382186-46382208 CAGCTGGGCATGGAAAACAATGG - Intergenic
1126479809 15:49105286-49105308 CAGCTAGCTGTGAGAAACCATGG + Intergenic
1127111695 15:55679981-55680003 AAGCTATGAATGAGATAAAACGG + Intronic
1128836476 15:70812929-70812951 CAGCCAGGACTGAGAACCACTGG - Intergenic
1130141908 15:81234667-81234689 CAGGAAGGAATGAAAAATAATGG - Intronic
1130287137 15:82565428-82565450 CAGCTGGGAATCAGAAGGAAAGG + Intronic
1130793162 15:87178341-87178363 CAGACAGGAATGAGAAGCACAGG - Intergenic
1130805852 15:87321176-87321198 CAGCAAGGATTTGGAAACAAAGG + Intergenic
1130888965 15:88117022-88117044 CAGCTAAGGTTGAGGAACAATGG - Intronic
1132086256 15:98910739-98910761 CAGCTAGGGCTGACAAACAACGG - Intronic
1132178169 15:99732248-99732270 CAGCTATGGATGAGGAACAGGGG - Intronic
1132355269 15:101166995-101167017 CAGATAGCAATGATAAACTATGG - Intergenic
1133923837 16:10178996-10179018 AAGTGAGGAATGAGAAAAAAGGG - Intronic
1134845302 16:17435017-17435039 CAGCTAGGAAAGATGAACTAAGG - Intronic
1135670548 16:24371879-24371901 CAGCTAGGGCTGAGAACCACTGG - Intergenic
1136681293 16:31964736-31964758 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1136781605 16:32906248-32906270 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1136888188 16:33947592-33947614 CTGCTGGAAATGAGCAACAAGGG - Intergenic
1137392743 16:48094857-48094879 CACCTAGCAAGGTGAAACAAAGG + Intronic
1138033045 16:53576425-53576447 AAGCCAGGAATGATCAACAAAGG + Intergenic
1138701106 16:58864507-58864529 CAGCTGGACCTGAGAAACAACGG - Intergenic
1138897545 16:61226191-61226213 CACCCAGAAATGGGAAACAATGG - Intergenic
1139324708 16:66143513-66143535 CAGCTGGGACTGAGAACCACTGG - Intergenic
1141169925 16:81684814-81684836 CACCTAGGAAGGAGAAAAGAAGG - Intronic
1203084260 16_KI270728v1_random:1170230-1170252 CTGCTGGAAATGAGCAACAAGGG + Intergenic
1143637911 17:8176847-8176869 AAGCTGGGCCTGAGAAACAAGGG + Intergenic
1144463323 17:15476173-15476195 GAGCAAGGATTGAGAAACACTGG - Intronic
1145117233 17:20222937-20222959 CAGCAAGAAAAAAGAAACAAAGG - Intronic
1146340521 17:32015496-32015518 CAGATACCAATTAGAAACAAGGG + Intronic
1146534304 17:33636919-33636941 CAGCTTTGAAAGAGAAAAAAGGG + Intronic
1146636757 17:34512220-34512242 CAGATAGAAGTTAGAAACAAGGG + Intergenic
1147553625 17:41462610-41462632 CAGCTTGGAATGAGATAGAATGG + Intronic
1148327230 17:46790325-46790347 CAGCCAGGGATGAGAACCAATGG - Intronic
1148822853 17:50370421-50370443 CAGCTAGGAAGGGGAAGCCAAGG + Intronic
1151138224 17:71967926-71967948 CAGGAGGGAATGAGAACCAATGG - Intergenic
1151315695 17:73320961-73320983 CAGCTAGGAATGAGGAGTCAGGG + Intergenic
1153297338 18:3560118-3560140 CAGTTAAGAATGAGAAAAATGGG + Intronic
1154042845 18:10875420-10875442 GATCAAGGAATGAGAAAAAATGG + Intronic
1154043845 18:10885582-10885604 CATCTAGAAATGAGAACGAATGG + Intronic
1156837169 18:41568088-41568110 CAGTGAGGAAAGAGAAAAAATGG - Intergenic
1157980927 18:52379550-52379572 CAGCTAGGAAAGTGAATTAAAGG - Intronic
1159878552 18:73835796-73835818 AAGCAAGGAATTAGGAACAAGGG - Intergenic
1160304750 18:77721951-77721973 CATTTAGGATTGAAAAACAAAGG + Intergenic
1164926159 19:32131650-32131672 AAACTATGAATGAAAAACAAAGG + Intergenic
1166460701 19:42985475-42985497 CAGCTACAAATGAGAAGGAAGGG + Intronic
1167291776 19:48628789-48628811 CAGACAGGAAGGAGAAACAGCGG - Exonic
1167785296 19:51630674-51630696 CAGAAAGAAAAGAGAAACAAGGG + Intronic
1168200670 19:54813190-54813212 CAGCGATGAAGGAGAAAGAAGGG - Intronic
1168449789 19:56457434-56457456 CAGCTAGGAAGGAGCAGCAGAGG - Intronic
925181109 2:1817443-1817465 CTGCTGGGAATGACAAATAATGG + Intronic
925998674 2:9312639-9312661 GAGCCAGGAATGAGACACCATGG - Intronic
926427737 2:12754739-12754761 CCCATAGGAAGGAGAAACAATGG + Intergenic
929112614 2:38418105-38418127 AAACTAGGAATGTGAAAAAAAGG + Intergenic
929851326 2:45593066-45593088 CAGATAGGAATGAGAGTAAAGGG + Intronic
931287087 2:60841262-60841284 CAGCCAGGGTTGAGAAACACTGG + Intergenic
931294754 2:60911076-60911098 AAGTTAAGAATGAGAAACCAAGG + Intronic
931444978 2:62319392-62319414 CAGCCTGGATTGAGAAAAAAAGG + Intergenic
931495936 2:62807245-62807267 CAGTTAAGAATAAGAAAAAATGG + Intronic
933828436 2:86185927-86185949 CATCAAGGAATTAGAAACATAGG + Intronic
934506699 2:94900062-94900084 CGGCTAGGACTGGGAGACAAAGG + Intergenic
938309081 2:130274503-130274525 CAGCTAGGACTGGGAGAGAAAGG - Intergenic
938446028 2:131379555-131379577 CAGCTAGGACTGTGAGAGAAAGG + Intergenic
938446420 2:131383570-131383592 CAGCTAGGACTGGGAGAGAAAGG + Intergenic
938905288 2:135830986-135831008 CAGCAAGGCATGAGAACCACTGG - Intronic
938981318 2:136529954-136529976 CTTCAAGGAAGGAGAAACAAGGG - Intergenic
939122030 2:138128883-138128905 GAGGTGGGAGTGAGAAACAAAGG + Intergenic
940840389 2:158573428-158573450 GATCTAGGAAAGAGAAACCAAGG + Intronic
940937580 2:159515051-159515073 CATCTAGGAATGTTAAAAAATGG - Intronic
942419100 2:175789877-175789899 CAGATAGGAAGGAGAAAGACTGG + Intergenic
942611894 2:177750881-177750903 GAGCTAGGAATGAAAAGCACAGG - Intronic
942842923 2:180385292-180385314 CAGTTAGCAATGAGAATTAAAGG - Intergenic
943732367 2:191315965-191315987 CATCTAGGGATGAGAACCATAGG + Intronic
943990406 2:194682685-194682707 CAACAAGGAGTGAGAAAGAAAGG + Intergenic
944761011 2:202813746-202813768 CAGCTTTGAAAGAAAAACAAAGG + Intronic
944851986 2:203729018-203729040 CAGCTAGGATGGAAAATCAATGG + Intronic
944908086 2:204282794-204282816 CAGCAAGGAATGAAAACAAAGGG - Intergenic
945687116 2:212985206-212985228 CCTATTGGAATGAGAAACAAGGG - Intergenic
945736465 2:213606858-213606880 CATCTTGGCATCAGAAACAATGG + Intronic
948116967 2:235500511-235500533 CAGCAAGGAAGAAGAAACAACGG - Intronic
1168793539 20:596084-596106 CAGCCAGGGCTGAGAAGCAATGG - Intergenic
1169016491 20:2297029-2297051 CAGCAAGGAATGGGAGACAGGGG - Intronic
1169089123 20:2847205-2847227 CAGGTGGGAAGGAGACACAATGG - Intronic
1170339443 20:15306999-15307021 GAGGGAGGAATGAGAAACAGGGG + Intronic
1171894295 20:30745455-30745477 CGGCTAGGACTCAGAGACAAAGG + Intergenic
1172512613 20:35511156-35511178 CAGCCAGGATTGAGAATCACTGG + Intronic
1172956460 20:38763103-38763125 CAGCTCGGAATGGCAACCAAAGG - Intronic
1174671457 20:52311646-52311668 CAGCTAAGAAAGGGAAACAGGGG - Intergenic
1174720377 20:52805520-52805542 CAACTAGAAGTGAGAAAGAAAGG + Intergenic
1176695517 21:9972582-9972604 CAGCTAGGCATCAGAGACTATGG - Intergenic
1179623113 21:42631884-42631906 CAGCCAGGGCTGAGAACCAATGG - Intergenic
1179662617 21:42886855-42886877 CAGAAAGGGAAGAGAAACAAGGG + Intronic
1180710270 22:17834929-17834951 CAGCTGGGAAAGAGGAACCAGGG - Intronic
1180998993 22:19979250-19979272 CAGCTAGGAAGGAGCCCCAAAGG + Intronic
1181139332 22:20792596-20792618 CAGCTAGGAGTGACGAAGAAAGG + Intronic
1182407322 22:30146701-30146723 AAGGTAGGAATAAGAAATAAAGG + Intronic
1184441080 22:44516366-44516388 CTGGTAAGAAAGAGAAACAAAGG - Intergenic
1185317105 22:50184008-50184030 CAGCGAACAATGAGAATCAATGG + Intergenic
950935124 3:16831764-16831786 CAGCTTGAAAGAAGAAACAAAGG + Intronic
951907155 3:27716705-27716727 CAAATAGAAATGAGAATCAAAGG + Exonic
951989807 3:28664139-28664161 TTTCTAGGAATAAGAAACAAGGG - Intergenic
952356552 3:32590283-32590305 GAGGGAGGAATGAGAAACAGGGG + Intergenic
953471326 3:43169146-43169168 GAGCTAGGAAAGAGGAAGAAGGG + Intergenic
953679452 3:45028692-45028714 CAGCCAGGAATGAGAATCTCAGG + Intronic
954104422 3:48402112-48402134 CGGGTGGTAATGAGAAACAAAGG + Intergenic
955753540 3:62205807-62205829 CTACTAGAAATGAGAAACCAGGG + Intronic
955788357 3:62563452-62563474 CAGTTGGGAATCAGAAACAGAGG + Intronic
956755054 3:72377310-72377332 CATGTAGAAAGGAGAAACAAGGG + Exonic
957215043 3:77309122-77309144 TAGCTAGGATTGAGAACCACTGG + Intronic
958784165 3:98578927-98578949 TACCTAGGAATGAGGAACTATGG + Intronic
960711127 3:120529567-120529589 CGGCAAGAAATGAGAAATAAAGG - Intergenic
960906493 3:122606774-122606796 CAGCTAGGGCTGAGAATCACTGG + Intronic
961058366 3:123807991-123808013 CAGCTGTGGATGAGAAACAATGG + Intronic
961390176 3:126547891-126547913 CATCATGGAATGAGAAACAGTGG + Intronic
962164654 3:133036838-133036860 CAGCTAGGCTTGAGAACCACTGG + Intergenic
962810112 3:138952262-138952284 GAGCCAGGAATGAGGACCAAGGG - Exonic
963342652 3:144055810-144055832 CAGGTATGAATCAGACACAAAGG - Intergenic
965135906 3:164767757-164767779 CAGCTAAGAATAAAAAGCAATGG + Intergenic
965969382 3:174534887-174534909 CAGCTAAGATTGAGAACCACTGG - Intronic
966050250 3:175607847-175607869 CAGCTAGGAATGAGAAACAATGG + Intronic
967186872 3:186951424-186951446 CAGCCAGGGTTGAGAACCAATGG - Intronic
967684112 3:192399727-192399749 CAGCTAGGGCTGAGAACCAGTGG + Intronic
968290902 3:197539057-197539079 CAGCCAGGAATGAAAAAGGACGG - Intronic
969051672 4:4377678-4377700 GAGCTGGGCCTGAGAAACAAGGG + Intronic
969842804 4:9895291-9895313 CAGCTTTGAAAGAGAAAGAAGGG + Intronic
970104977 4:12571931-12571953 CAGCTTGGAATGAAAAAAAGTGG - Intergenic
970230721 4:13907890-13907912 CACCTAAGAATGAGAACCACTGG - Intergenic
971082278 4:23227207-23227229 GAGGTAGAAATGAGAACCAATGG + Intergenic
971306478 4:25486944-25486966 CACCCAGGAATGAACAACAATGG - Intergenic
971755822 4:30706905-30706927 CAGCTAGGATGCAGAGACAAAGG - Intergenic
971783892 4:31075566-31075588 GCACTAGGAGTGAGAAACAAAGG + Intronic
971916548 4:32877018-32877040 CAGATAGGAATGAGAAGCCTAGG - Intergenic
972351838 4:38243347-38243369 CAGCTATGGAAGAGAAATAAAGG + Intergenic
973006445 4:45013092-45013114 CTGCTAGGAAGGAAAAACACAGG + Intergenic
974773663 4:66450575-66450597 TAGATAGGATAGAGAAACAATGG + Intergenic
975569886 4:75804497-75804519 CAGCCAGGGTTGAGAATCAATGG - Intronic
975748669 4:77500119-77500141 CAGCAAGAAAAGAGAAACAAAGG + Intergenic
977469648 4:97426696-97426718 CAGGCAGGAAAAAGAAACAAAGG - Intronic
977727040 4:100308207-100308229 CAGTTAGGAAACAGAAACAGAGG - Intergenic
978151188 4:105437289-105437311 CTTCTAGGAGTGAGAAAAAAGGG + Intronic
979657554 4:123213605-123213627 AGGCTAGGAATGACAAATAATGG + Intronic
980226071 4:129987609-129987631 TAGTTAGGAAGCAGAAACAATGG - Intergenic
980510760 4:133784747-133784769 CTGCTACAAATGAGAAACAGAGG - Intergenic
980923495 4:139111898-139111920 GAGCTATGAATGAGAAACCAAGG + Intronic
982147029 4:152405940-152405962 CAGCTAGAAATGCAAAACTATGG + Intronic
985751841 5:1684277-1684299 AAGGAAGGAAAGAGAAACAAAGG + Intergenic
986048677 5:4066164-4066186 CAGCTACTGATGAGAAAAAATGG + Intergenic
986240614 5:5956483-5956505 CAGGTTGAGATGAGAAACAAAGG + Intergenic
986638641 5:9850024-9850046 CAGATAGGAGTGAGAGACAGTGG - Intergenic
986967609 5:13294156-13294178 CATCTAGGAATTAGGAATAAGGG + Intergenic
987328478 5:16834030-16834052 CAGCTTGGCAGGTGAAACAATGG - Intronic
988116180 5:26894261-26894283 CAGCTAGCAATGAGCACAAAAGG - Intronic
988654090 5:33188957-33188979 AAGCTGGGATTAAGAAACAAAGG - Intergenic
989141014 5:38201458-38201480 CTAGTAGAAATGAGAAACAAGGG - Intergenic
989316192 5:40081937-40081959 TAGCTAGGGAGGAAAAACAAAGG + Intergenic
991050798 5:62271163-62271185 CATCTAGTAATGAAAAAGAAGGG - Intergenic
992712307 5:79471604-79471626 CAGCCAGGGTTGAGAAACACTGG - Intronic
993047281 5:82881560-82881582 CAGCTGTGACAGAGAAACAAAGG + Intergenic
993443399 5:87981936-87981958 GAGCTAAAAATGAGAAAGAAAGG - Intergenic
993510758 5:88769073-88769095 CAGCATGGAAAGAGAAAAAAGGG + Intronic
994172197 5:96669845-96669867 CAGCCAGGATTGAGAACCACTGG - Intronic
995068300 5:107887847-107887869 CAGCTAGGGCTGAGAACCACTGG + Intronic
995087869 5:108135987-108136009 CATCAATGAATGAGCAACAATGG + Intronic
995327155 5:110903789-110903811 CAGCTAGGACTGTGAAACTAAGG + Intergenic
995652037 5:114380689-114380711 CAGTTACATATGAGAAACAAAGG - Intronic
996301602 5:121993346-121993368 CTTCTAGGTATGAGAAACACAGG - Intronic
996384676 5:122898818-122898840 CAGCCAGAATTGAGAATCAATGG + Intronic
997713576 5:136026524-136026546 CAGCTAGGAAGTAGAAAGACTGG + Intergenic
997968244 5:138377259-138377281 CAGATAAGTATGAGAAACACTGG + Intronic
998072262 5:139207319-139207341 CAGCTAAAAATGAGACACACAGG + Intronic
998910940 5:146959607-146959629 CAGCTGGGAATGAGACAGAGAGG + Intronic
999433196 5:151541574-151541596 CACCTGGGGATGAGAAAAAAAGG + Intronic
999643264 5:153693178-153693200 CAGATAGGAATGAAAGAAAATGG + Intronic
999700358 5:154222108-154222130 CAGAGAGGAATGGGTAACAAAGG - Intronic
999854750 5:155581810-155581832 AAGCTAGGAAAGAGACAGAATGG + Intergenic
1001452425 5:171836842-171836864 CCTCTAGGAATGAGCCACAAGGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003551369 6:7105223-7105245 TAGCTAGAAATGAGAAACACAGG + Intergenic
1003559676 6:7170374-7170396 CAGTGAGGAGTGAGCAACAAGGG - Intronic
1003976901 6:11353166-11353188 CAGCCAGGAAAGAGAAAAACAGG - Intronic
1004582445 6:16967011-16967033 CAGCCAGGATTGTGAATCAATGG + Intergenic
1004759127 6:18646815-18646837 CAGCTAAGACTGAGAATCACTGG - Intergenic
1006404683 6:33838078-33838100 AAGGTAGGAATGACAAGCAAGGG + Intergenic
1008164480 6:48119493-48119515 GAGCAAGGAATTAGAAAGAAAGG + Intergenic
1009737969 6:67703400-67703422 AATCTAGCAGTGAGAAACAAGGG - Intergenic
1010021332 6:71163123-71163145 CAGCCAGGTGTGAGAGACAAAGG - Intergenic
1010360733 6:74990385-74990407 CAGTAAGGAATGAAAAACAATGG + Intergenic
1010928476 6:81771900-81771922 CAGCTAGGAATCAGGAAGCAAGG + Intergenic
1010984926 6:82412779-82412801 CAGAGAGGTAAGAGAAACAAAGG + Intergenic
1011461421 6:87609403-87609425 GAGCCAAGAATGAGAATCAAAGG + Intronic
1011465957 6:87657241-87657263 CAGCTAGCAATAAGAGAAAATGG + Intronic
1012139948 6:95613722-95613744 AAGGTGGGAATGAGAAAGAAAGG - Intergenic
1012235652 6:96811344-96811366 CAGGTAGGAATGTGAAATACTGG + Intronic
1012522633 6:100138848-100138870 GAGCTGGGAATCACAAACAATGG - Intergenic
1013289920 6:108711052-108711074 GAGATAGGAATGAGAATGAAGGG - Intergenic
1013767700 6:113593975-113593997 CAGCCAGGACTGAGAACCACTGG - Intergenic
1014131346 6:117837875-117837897 CAGATAGCAATGAGAAACATAGG + Intergenic
1015087432 6:129311921-129311943 CAGCAAGAAATGTAAAACAAAGG + Intronic
1015156932 6:130107070-130107092 CAGCCAGGAGTGAGAAGCAGTGG + Intronic
1015454044 6:133404949-133404971 CAGCTACGAATGAGTAAGCAGGG - Intronic
1015803858 6:137089358-137089380 CAGCTTAGCATGAGAATCAAAGG + Intergenic
1016651289 6:146463833-146463855 CAGCTAAGGTTGAGAAACTATGG + Intergenic
1017394972 6:153988185-153988207 CAGATAAGAATGAAAACCAAGGG + Intergenic
1019662317 7:2231759-2231781 CAACTAGGTATCAGAAAGAAAGG + Intronic
1019798131 7:3067231-3067253 CTCCTAGGAACCAGAAACAAGGG - Intergenic
1021542456 7:21775193-21775215 CAATTAGGAAAGAGAAACCAGGG + Intronic
1021605757 7:22407548-22407570 CAGCTATGGATGAGGAAGAAAGG + Intergenic
1022127656 7:27373764-27373786 CAGGAAGGAAAGAGAAAAAATGG - Intergenic
1022488990 7:30802118-30802140 CATCTTGGAGTGAGAAAAAAAGG - Intronic
1022946832 7:35293987-35294009 CAGATAGGTATGAAAGACAAAGG - Intergenic
1023258129 7:38331931-38331953 CAGCTGGGAATGAGAAAGGCAGG + Intergenic
1023258782 7:38337621-38337643 CAGCTGGGAATGAGAAAGGGAGG + Intergenic
1023259770 7:38346606-38346628 CAGCTGGGAATGAGAAAGGGAGG + Intergenic
1023260245 7:38350935-38350957 CAGCTGGGAATGAGAAAGGGAGG + Intergenic
1023261222 7:38360086-38360108 CAGCTGGGAATGAGAAAGGGAGG + Intergenic
1023261738 7:38364898-38364920 CAGCTGGGAATGAGAAAGGGAGG + Intergenic
1023649916 7:42358771-42358793 CAGGTAGTAATGAGACACAGGGG - Intergenic
1024403561 7:48951766-48951788 CAGCTGGGAAGGTGAAAAAAAGG - Intergenic
1025229155 7:57188482-57188504 CAGCTAGGACTGGGAGAGAAAGG - Intergenic
1026382905 7:69817343-69817365 CAGCAAGGAATGAGTAAGACAGG - Intronic
1027520033 7:79195156-79195178 CACCTAGCAATCAAAAACAATGG + Intronic
1027937752 7:84631686-84631708 CAGATGGAAATGAGAAACATGGG + Intergenic
1028167702 7:87557246-87557268 CAGCTGTGAATCAGAAACAGAGG - Intronic
1028536393 7:91892533-91892555 AAGCTAGGATTGAGAACCACAGG - Intergenic
1029097705 7:98102157-98102179 CAACTAGGAATGAGAAACGAGGG + Intergenic
1029213247 7:98926343-98926365 CAACTACAAATCAGAAACAAAGG + Intronic
1030677189 7:112396250-112396272 CAGATAGGTATGAGAAACTGTGG - Intergenic
1031149372 7:118035413-118035435 CAGCTAGGGTTGAGAACCATTGG + Intergenic
1034353350 7:150431707-150431729 CACCTAGGAAAGAAAATCAACGG - Intergenic
1037460119 8:19100447-19100469 AACCAAGGAATGAGAAACCAAGG + Intergenic
1038093612 8:24282796-24282818 AAGCTGGGAATGAGAGAAAAAGG - Intergenic
1039033508 8:33334100-33334122 CAGCTATGAATAAGATAAAATGG - Intergenic
1039230474 8:35441216-35441238 AAGCTAGGAAAGAGAAACCATGG - Intronic
1039450251 8:37667736-37667758 CAGCTAAGCAAGAGAAAAAATGG + Intergenic
1039835948 8:41256461-41256483 CAGCTATGAATGAGAAACACAGG - Intergenic
1041021645 8:53644058-53644080 CAGCTAAGAATGAGGAAGGAGGG - Intergenic
1041099072 8:54378663-54378685 GACCTAGGAATGAGAAAAGAAGG + Intergenic
1041893410 8:62896904-62896926 AAGCAAGGAATGAAAAACAGAGG + Intronic
1042144167 8:65710909-65710931 CAGCTAGGTATGAGAAAGAAAGG + Intronic
1043066562 8:75579004-75579026 CAACTATGAATAAGAAAAAAAGG + Intergenic
1043334928 8:79163672-79163694 CAGTTAGGAATGAGGAGAAAAGG - Intergenic
1044046567 8:87442291-87442313 CAATTAGGCATGAGAAATAAAGG - Intronic
1044324290 8:90842384-90842406 CTTTAAGGAATGAGAAACAATGG - Intronic
1044623764 8:94216606-94216628 CTCCTAAGTATGAGAAACAAAGG + Intronic
1044661526 8:94596066-94596088 CAGCCAGGATTGAGAACCACAGG - Intergenic
1046640974 8:116731177-116731199 CAGCTGGGAATGAGTAAATAGGG - Intronic
1046995590 8:120517972-120517994 CAGCTAGGAATTGGAACCAATGG - Exonic
1047290776 8:123528197-123528219 CAGCCAGGACTGAGAACCACTGG + Intronic
1047351959 8:124082660-124082682 CAGCTCTGATTGAGAACCAAGGG + Intronic
1047819613 8:128504186-128504208 CATGAAGGAATGAGAAACAGTGG - Intergenic
1048447166 8:134499992-134500014 CTGGTGGGAATGAAAAACAAGGG + Intronic
1049020545 8:139954712-139954734 CAGCTAACAATAAGGAACAAAGG + Intronic
1049112211 8:140653804-140653826 CAGCTAGAAATGTGAAATTATGG + Intergenic
1050386579 9:5097244-5097266 CGGCTAGGACTGAGAGAGAAAGG - Intronic
1050681745 9:8119376-8119398 CAGAGAGGACTGAGTAACAAAGG - Intergenic
1051077973 9:13262653-13262675 AGGTTAGGAATGAGAAAAAAAGG + Intronic
1051180568 9:14407514-14407536 CAGATGAGAATGAGCAACAAAGG + Intergenic
1051244549 9:15096727-15096749 CAGGTAGGAATGGGAAAGAGTGG - Intergenic
1051355446 9:16235933-16235955 CAGATGGGAATGTGAAATAAGGG - Intronic
1051679768 9:19595397-19595419 CAGCTAAGAATGGGACACAAAGG + Intronic
1052376900 9:27727861-27727883 CAGCAAAAAATGAAAAACAAGGG + Intergenic
1053028520 9:34753174-34753196 CAGGTAAGAGTAAGAAACAAAGG + Intergenic
1054844074 9:69773961-69773983 CAATTATGAATGAGAATCAATGG - Intergenic
1058224649 9:102344931-102344953 CAACTAGTAATGAGAATAAAGGG - Intergenic
1058421759 9:104839238-104839260 CAGCTAAGAATGGGAAACAAAGG + Intronic
1059136345 9:111810335-111810357 CAGCTAGGAATGAACAAAGATGG - Intergenic
1059772296 9:117438783-117438805 CAGCTAGACCTCAGAAACAAAGG + Intergenic
1061198773 9:129124094-129124116 AAGCTGGGTATGAGAAACACAGG - Intronic
1061592744 9:131608543-131608565 CAGCTAGCAAGGAGAAAGCAAGG + Intronic
1186565925 X:10662389-10662411 CAGCTAGGAATGCAAAACTATGG - Intronic
1186566061 X:10664072-10664094 CAGCTAGGAATGCAAAACTATGG + Intronic
1186668427 X:11743589-11743611 CAGCTAACAATGAGAAAATATGG - Intergenic
1187161214 X:16766985-16767007 CAGCTAAGATTGAGAACCACGGG + Intergenic
1187675394 X:21711226-21711248 AATTTAGAAATGAGAAACAATGG + Intronic
1188047065 X:25438101-25438123 CAGCTGGGAGTAAGAAACATAGG - Intergenic
1188499639 X:30811132-30811154 CAGCCAGGAATTAGAACCACTGG - Intergenic
1189769535 X:44410339-44410361 CAGCAAGGAATGAAAAATAAGGG + Intergenic
1189905430 X:45754353-45754375 TAGCTAGAAATGGGAAGCAAGGG - Intergenic
1190965082 X:55291929-55291951 GAGCTAAAAATGAGAAAAAACGG - Intergenic
1191831086 X:65417088-65417110 CAGGTAGGTTTGAGAAGCAATGG - Intronic
1192603867 X:72493257-72493279 CAGCAAGTAATGAGAGATAAGGG + Intronic
1193340332 X:80341663-80341685 CAGCTACAACTGACAAACAATGG - Intronic
1194551576 X:95307438-95307460 CAGCTAGGAATGGAGAAAAATGG + Intergenic
1195728450 X:107940923-107940945 GAGCTATGAATGAAAAATAAGGG + Intergenic
1195852999 X:109303470-109303492 CAGCTTAGAAAGAGAAACAAAGG + Intergenic
1196459123 X:115911847-115911869 TAGCTAGGACTAAGAAGCAAGGG + Intergenic
1196599454 X:117585102-117585124 CACCCAGGAAGGAGAAACAGCGG - Intergenic
1198194656 X:134347939-134347961 CAGGAAGGAATGAGGAGCAATGG + Intergenic
1198325511 X:135567719-135567741 CAGAAAGGAATGAGAGACCATGG - Intronic
1198654981 X:138903930-138903952 TAGGTAGGAAGGGGAAACAAAGG + Intronic
1198711477 X:139508820-139508842 CAGTGTGGAATGAGAGACAATGG + Intergenic
1199819181 X:151427643-151427665 GAGGTAGGAATGAGAAGCAGTGG + Intergenic
1201543126 Y:15131396-15131418 CAGCTAAAAATGAGAGACCATGG - Intergenic