ID: 966055119

View in Genome Browser
Species Human (GRCh38)
Location 3:175677615-175677637
Sequence GATGAAGGAGTCCCTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966055119 Original CRISPR GATGAAGGAGTCCCTGGAGG GGG (reversed) Intronic
900117241 1:1033921-1033943 GACGCCGGGGTCCCTGGAGGCGG + Intronic
900394213 1:2446484-2446506 GCTGCAGGGGTCCCAGGAGGCGG + Intronic
900896021 1:5483485-5483507 GGTACAGCAGTCCCTGGAGGTGG + Intergenic
901275432 1:7987336-7987358 TGTGAAGGAGTCCTTGGGGGAGG + Intergenic
901825829 1:11860247-11860269 GATGAAGGAGGCACTGGGAGAGG - Intergenic
901887032 1:12230338-12230360 GACGCAGGGGTCCCCGGAGGTGG - Intronic
902404310 1:16174555-16174577 GAGGGAGGATTCCCTGGGGGAGG - Intergenic
902528704 1:17076544-17076566 GAGGAAGGGCTTCCTGGAGGAGG - Intronic
902827641 1:18987935-18987957 CAGGAAGGAGTCCTGGGAGGTGG + Intergenic
903214919 1:21838649-21838671 GATGGAGGGCTTCCTGGAGGTGG + Intronic
903390901 1:22963106-22963128 GTTGAAGGAGGCCCTGGAAAAGG - Exonic
903454858 1:23480465-23480487 GAGGGAGAAGTTCCTGGAGGAGG - Intronic
903653346 1:24934060-24934082 GATTAAGGATTCCCTCTAGGAGG + Intronic
904030891 1:27532804-27532826 AGTGAGGGAGTTCCTGGAGGAGG - Intergenic
906142507 1:43542165-43542187 GATGAGGGAGGCCCTGGAGCTGG + Intronic
906157909 1:43624903-43624925 GGTGAAGGACTCAATGGAGGTGG - Intergenic
906562824 1:46771804-46771826 GATCAAGGATTCTCTGGAAGGGG - Intronic
906571556 1:46846116-46846138 TTTGAAGGAGACCCTGGGGGAGG + Intergenic
906704654 1:47886206-47886228 CATGGAGGGCTCCCTGGAGGAGG - Intronic
907247453 1:53117086-53117108 CAGGAAGGGCTCCCTGGAGGAGG + Intronic
907283031 1:53363164-53363186 GATGAAGGGTCCCTTGGAGGTGG - Intergenic
907309825 1:53532878-53532900 AGGGAAGGAGTCCCAGGAGGGGG - Intronic
908267508 1:62393884-62393906 GATGATGGAAGCCCTGGGGGTGG - Intergenic
908438880 1:64133481-64133503 GAAGGAGGAGACCCTGGAGGTGG + Intronic
910523930 1:88155872-88155894 GAGGATGGAGGGCCTGGAGGTGG - Intergenic
910679927 1:89852687-89852709 GAGGAAGGAATTCCTGAAGGAGG + Intronic
913193706 1:116434797-116434819 GATTAAGGAGTCGGTGGGGGTGG - Intergenic
913239840 1:116820360-116820382 GAGGATGGAGGCCCTGGAGCCGG + Intergenic
913487719 1:119348760-119348782 GATCAGGGATTCTCTGGAGGGGG + Intergenic
913971548 1:143421406-143421428 CCTGAAGGGATCCCTGGAGGGGG - Intergenic
914065925 1:144247019-144247041 CCTGAAGGGATCCCTGGAGGGGG - Intergenic
914113226 1:144719335-144719357 CCTGAAGGGATCCCTGGAGGGGG + Intergenic
914381714 1:147122172-147122194 GATCAGGGATTCTCTGGAGGGGG - Intergenic
915470593 1:156123609-156123631 AAAGAAGTAGTGCCTGGAGGAGG - Intronic
915836681 1:159182231-159182253 GAAGAGGGAGTCCCTGAAGATGG - Intronic
916623486 1:166527342-166527364 GATCAGGGATTCTCTGGAGGGGG - Intergenic
917534407 1:175863967-175863989 GATAGAGGAGTCGCTCGAGGAGG + Intergenic
917670269 1:177267046-177267068 AATGAATGAGTCCCTGGACATGG + Intronic
918182138 1:182093622-182093644 GATGAGGGACTCTCTGGAGAAGG + Intergenic
919757148 1:201073363-201073385 AGTGCAGGAGTCCCTGGAGATGG + Intronic
920799702 1:209174477-209174499 GAGGGAGGAGCCCCTGGAGATGG + Intergenic
921227279 1:213032723-213032745 GGTCAAGGATTCCCTTGAGGGGG - Intergenic
921734531 1:218612147-218612169 GAGGAAGGAGGTCCAGGAGGAGG - Intergenic
922236191 1:223724330-223724352 GATGATTGAGCCCCAGGAGGAGG + Intronic
922909668 1:229205011-229205033 GAGGAAGGAGTGGGTGGAGGGGG + Intergenic
923942320 1:238842087-238842109 GATGAAGGAGAACGGGGAGGGGG - Intergenic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1062883149 10:995013-995035 GGTGCAGGAGACCCAGGAGGTGG + Intronic
1063817246 10:9789810-9789832 TAAGAAGGGGTCCCAGGAGGTGG - Intergenic
1064330595 10:14390575-14390597 GATGGAGGGCTTCCTGGAGGAGG - Intronic
1064778126 10:18802986-18803008 TCTGAATTAGTCCCTGGAGGTGG + Intergenic
1065508411 10:26453503-26453525 GATGAATGAGTGGATGGAGGAGG - Intronic
1065960802 10:30732565-30732587 GCTGAAGGGCTCCATGGAGGAGG - Intergenic
1066095543 10:32068773-32068795 CATGGAGGAATCCCTGGAGCAGG + Intergenic
1067201170 10:44173054-44173076 GATTAATGAGACCATGGAGGGGG + Intergenic
1067842209 10:49690058-49690080 GCTGAAGGCTTCCCTGCAGGAGG + Intronic
1069920613 10:71813320-71813342 GATGGAGGAGTGGCAGGAGGAGG - Exonic
1070593330 10:77815906-77815928 GGTGACGGATTCCATGGAGGAGG + Intronic
1070837922 10:79462718-79462740 GATGAAGGTATCTCAGGAGGAGG + Intergenic
1071972337 10:90921061-90921083 GTGGAAGGAATCCCTGGAGTTGG + Exonic
1072525245 10:96265596-96265618 GATGAGGGATTGCCTAGAGGAGG - Intronic
1072583683 10:96762820-96762842 GAGGCAGGAGACCCGGGAGGCGG - Intergenic
1073210053 10:101792879-101792901 GAGGTAGGAGTCAGTGGAGGTGG + Exonic
1075438230 10:122460649-122460671 GCTGAGGGCGACCCTGGAGGTGG - Intergenic
1076403806 10:130199692-130199714 TTAGAAGGAGTCCCTGAAGGCGG + Intergenic
1076934915 10:133561381-133561403 AATGAGGGATTCCCTGGATGGGG - Intronic
1077246898 11:1544053-1544075 GATGAAGTAGTTCCTAGAGCTGG - Intergenic
1077308330 11:1877621-1877643 CCTGAAGGGATCCCTGGAGGGGG + Intronic
1077531080 11:3095222-3095244 GAGGAAGAAGGCCCAGGAGGCGG + Intronic
1078331891 11:10429132-10429154 GGCAAAGGAGTCCCTGGATGTGG + Intronic
1079094097 11:17499970-17499992 GATGTAGGTGCCCTTGGAGGAGG - Intronic
1079396615 11:20069138-20069160 CAGGAAGGACTTCCTGGAGGAGG + Intronic
1080660929 11:34295343-34295365 GAGGAACGAGTCCCTGCTGGAGG + Intronic
1081607880 11:44538508-44538530 GAGGAAGGAGGCCCTGGGAGAGG - Intergenic
1081712632 11:45227139-45227161 CATCAAGGACTACCTGGAGGTGG + Intronic
1082950617 11:58811336-58811358 GATTAAGGATTCTCTGAAGGGGG - Intergenic
1083055596 11:59816125-59816147 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1083348728 11:62012385-62012407 GAAGATCAAGTCCCTGGAGGAGG - Intergenic
1083694943 11:64436538-64436560 CATGAAAAAGGCCCTGGAGGGGG + Intergenic
1083782499 11:64925573-64925595 GTTGCAGGAGGCCCTGGGGGGGG + Exonic
1083920342 11:65778929-65778951 GCTGAGGGAGCCCCTGAAGGTGG - Exonic
1084771867 11:71348574-71348596 AAGGAACGAGTCTCTGGAGGTGG - Intergenic
1084967671 11:72752814-72752836 GAGGAAGGATTTCCTAGAGGAGG - Intronic
1085173055 11:74464987-74465009 GAAGGAGGAGTCCCAGGAGAAGG - Intronic
1085286272 11:75363757-75363779 GCTGGAGGATTCCCAGGAGGTGG - Intergenic
1085308576 11:75502221-75502243 GAGAAGGGAGTCCCTGGAGCAGG - Intronic
1085527756 11:77173990-77174012 GAGGCAGGAGACCCTTGAGGAGG - Intronic
1087047927 11:93859273-93859295 GATCAGGGACTCTCTGGAGGGGG + Intergenic
1088259306 11:107928952-107928974 GAGGAAGTCGTCCCTGGAAGAGG - Intronic
1088429015 11:109736996-109737018 GAGGAAGATGTCACTGGAGGTGG + Intergenic
1088949624 11:114554313-114554335 GAGGAAAGAGAACCTGGAGGAGG - Intronic
1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG + Intronic
1089773383 11:120819158-120819180 GAGGAAGGAAGCCCTGCAGGCGG - Intronic
1090414195 11:126529322-126529344 GTTGAAGCAGGCCATGGAGGTGG + Intronic
1091983243 12:4883623-4883645 AATGATGGAGTGCTTGGAGGCGG + Intergenic
1092117338 12:6018848-6018870 GAGCAAGGAGTTCATGGAGGAGG - Exonic
1092192982 12:6533826-6533848 GAGGAAGGAGGCTCGGGAGGCGG - Intergenic
1092241588 12:6839320-6839342 GCTGCAGGAGTCACAGGAGGAGG + Exonic
1093521186 12:20051921-20051943 GATGAAGGAGTCAGTGCAGGAGG + Intergenic
1093669272 12:21853241-21853263 GAGGAAGAGGTTCCTGGAGGAGG + Intronic
1093683718 12:22031910-22031932 GATCAAGGAGTCCGTGGATTTGG - Intergenic
1093708579 12:22303251-22303273 GATCAGGGATTCTCTGGAGGGGG - Intronic
1094467723 12:30771379-30771401 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1096520240 12:52180867-52180889 GAGGAAGGAGCCCCTGGGGCAGG + Intronic
1096576974 12:52558937-52558959 GATGAGGGGGTGCCAGGAGGGGG - Intergenic
1098665933 12:73162947-73162969 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1102152520 12:110698681-110698703 GAGGAAGGAGACGCAGGAGGAGG - Intronic
1102164002 12:110791690-110791712 CAAGAAGGACTTCCTGGAGGAGG + Intergenic
1102257659 12:111425446-111425468 GGTGAAGGAGTCCCAGGCTGAGG + Intronic
1103317990 12:120072593-120072615 CATGGAGGAGTCCGTGGAGACGG - Exonic
1103446565 12:120999037-120999059 GATGCAGGGGAGCCTGGAGGAGG - Intronic
1103703959 12:122861531-122861553 GATGGGGGAGTTCCTGGACGGGG + Intronic
1103721767 12:122979094-122979116 CCTGACGGAGCCCCTGGAGGTGG + Exonic
1103961563 12:124611988-124612010 GCTGGAGGACTGCCTGGAGGAGG - Intergenic
1104030679 12:125064012-125064034 GATCAGGGAGGCTCTGGAGGGGG + Intergenic
1104658000 12:130588170-130588192 AATGAAGGGCTTCCTGGAGGAGG - Intronic
1104685222 12:130780512-130780534 GCTGCAGGAGTCGCTGGTGGAGG - Intergenic
1104996781 12:132663196-132663218 GATATAAGCGTCCCTGGAGGAGG - Intronic
1105015493 12:132784184-132784206 GCTGGAGGAGTCCCGGGAGAAGG - Exonic
1105070601 12:133232195-133232217 GATGAAGGGGTCCCTGTCTGTGG + Intronic
1105566674 13:21556045-21556067 GATGAAGCAGTAGATGGAGGTGG - Intronic
1108244088 13:48497936-48497958 GCTGAAGGTGTGCGTGGAGGAGG - Intronic
1108478288 13:50842914-50842936 GAGGAAGGAGTTCCAGGGGGAGG + Intronic
1108555220 13:51584744-51584766 GATGGAGGGGTCCCAGGAGGTGG + Exonic
1109179518 13:59197398-59197420 GATGAATAATTCCCAGGAGGAGG + Intergenic
1109724049 13:66316142-66316164 GATGAAGGAGTCAGAGGAGATGG - Intronic
1110126071 13:71943515-71943537 TCTGAAGGAGTTCTTGGAGGAGG + Intergenic
1112413721 13:99187214-99187236 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1112447314 13:99476048-99476070 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1113708600 13:112449629-112449651 ACTGAAGGAGACCCTGGTGGTGG - Intergenic
1114393617 14:22337026-22337048 CCTGAAGGAGACCCTTGAGGTGG - Intergenic
1115201056 14:30854591-30854613 GAGGAAGGGTTACCTGGAGGTGG - Intergenic
1117493067 14:56271886-56271908 GAAGAAAGAGTCCCTGGGGCTGG - Intronic
1117509182 14:56431616-56431638 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1118063604 14:62166915-62166937 GATGATGGAGTCCATAGAGAAGG + Intergenic
1118510456 14:66466094-66466116 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1119044611 14:71307725-71307747 TACAAAGGAGTCCCTGGAAGAGG + Intergenic
1121011194 14:90521211-90521233 GATCAAAGACTCCCTGGGGGAGG - Intergenic
1121537761 14:94702812-94702834 CATGGAGGACTTCCTGGAGGAGG - Intergenic
1122298535 14:100718938-100718960 GGTGGCGGAGGCCCTGGAGGAGG + Intergenic
1122596841 14:102899599-102899621 GCTGGAGGAGTGCCTGGAGCTGG - Intronic
1123058619 14:105584291-105584313 GCCGCAGGAGACCCTGGAGGAGG - Intergenic
1123082950 14:105704525-105704547 GCCGCAGGAGACCCTGGAGGAGG - Intergenic
1123106602 14:105844745-105844767 TATGAAGGGCTGCCTGGAGGAGG + Intergenic
1202907184 14_GL000194v1_random:81345-81367 GATGAAGGAGGCCAGGGAGCAGG + Intergenic
1123918548 15:25054793-25054815 GATGAAGAAATCCCTGCTGGGGG - Intergenic
1124494574 15:30178552-30178574 GATGATGGCGTCTCTGGAGCCGG - Intergenic
1124748996 15:32360093-32360115 GATGATGGCGTCTCTGGAGCCGG + Intergenic
1125153772 15:36563245-36563267 GATGAATAAGTTCATGGAGGAGG - Intergenic
1125480756 15:40078123-40078145 GATGAAGGAGTTCGTAGAAGGGG - Intergenic
1125922019 15:43530580-43530602 GATAAAGAGGTCCCTGGAGTTGG - Exonic
1127361378 15:58247603-58247625 GGTGAAGGAGGCCTTGGATGGGG + Intronic
1128373061 15:67054897-67054919 TATGGTGGAGTCCCTAGAGGAGG + Intergenic
1128733291 15:70035063-70035085 GATGAGGAAGGCCATGGAGGAGG - Intergenic
1128944555 15:71811832-71811854 GCTGAAGAAGTGCCTGCAGGCGG + Exonic
1129711263 15:77821245-77821267 GGTGGAGGAGGTCCTGGAGGAGG + Intergenic
1130045042 15:80436924-80436946 GATGCAGAAGGCTCTGGAGGAGG - Intronic
1133014048 16:2930717-2930739 AGTGGAGGAGCCCCTGGAGGGGG + Exonic
1133060432 16:3171207-3171229 GAGGAGGGAGTCCCCGGAGTGGG + Intergenic
1133421441 16:5650369-5650391 GATGGAGGAGGCCCTCGACGGGG - Intergenic
1134010465 16:10848402-10848424 GATTATTGAGTTCCTGGAGGAGG + Intergenic
1134109942 16:11508937-11508959 GCTGAAGGAAGCACTGGAGGGGG - Intronic
1134623106 16:15704730-15704752 GATGCAGCAGTCCCTGCAGTGGG - Intronic
1135250893 16:20900393-20900415 GATGCAGGAGGCGATGGAGGGGG - Intronic
1135693705 16:24567351-24567373 GCTGGAGGAAACCCTGGAGGAGG - Exonic
1136591335 16:31219465-31219487 GATGGAGAAGGTCCTGGAGGAGG + Exonic
1137625224 16:49903483-49903505 GATGAAGGGACGCCTGGAGGTGG - Intergenic
1137933532 16:52611206-52611228 GAAGAAGGAGTACCAGGAAGAGG + Intergenic
1140238275 16:73178472-73178494 GATGAAGGAGTCTTTGGGGTAGG - Intergenic
1140270268 16:73459146-73459168 GCTCATGGAGTCCCTGGATGTGG + Intergenic
1140419673 16:74807863-74807885 GATCAGGGATTCTCTGGAGGAGG - Intergenic
1141165683 16:81659423-81659445 GATGGAGGACTTCCAGGAGGAGG + Intronic
1141332734 16:83126958-83126980 GATGAAGGAGTAGAGGGAGGAGG + Intronic
1141478769 16:84292355-84292377 GGTGGAGGAGGCCCAGGAGGCGG + Intergenic
1141661484 16:85443931-85443953 GATAAAGGGGGCCCTGGGGGTGG + Intergenic
1142027992 16:87824632-87824654 GATGCAGGAGTCACAGGAAGGGG + Intergenic
1142134873 16:88447188-88447210 GATGAAAGACTGCCTGGAGGTGG - Intergenic
1142667441 17:1470930-1470952 GGAGAAGGACTCCCTGGAGCTGG + Intronic
1142737639 17:1911368-1911390 GGTGCAGGAGTCCCTGGAGGAGG - Intergenic
1142884452 17:2903987-2904009 GCAGAAGGATTCTCTGGAGGTGG + Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1143588073 17:7861574-7861596 GAAGTAGGAGTCTCTGGAAGAGG - Exonic
1144295346 17:13870012-13870034 AGTGGAGCAGTCCCTGGAGGAGG - Intergenic
1144455071 17:15412193-15412215 GATGGTGGAGTCCCTGGAAAGGG - Intergenic
1144678467 17:17176841-17176863 ACTCCAGGAGTCCCTGGAGGAGG - Intronic
1144825964 17:18105898-18105920 CTGGAAGGAGACCCTGGAGGAGG - Intronic
1144956357 17:19020844-19020866 GAGGGAGGAGCCCTTGGAGGTGG - Exonic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146442000 17:32905307-32905329 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147220171 17:38924011-38924033 GACGAAGGAGTGGGTGGAGGAGG + Intergenic
1147934176 17:44002034-44002056 GAGAAAGAAGGCCCTGGAGGTGG + Intronic
1148071929 17:44913760-44913782 GAAGATTGAGTCGCTGGAGGAGG - Exonic
1148682446 17:49482487-49482509 AATGGAGGACTTCCTGGAGGAGG + Intergenic
1148683094 17:49485921-49485943 AATGAGGGGGGCCCTGGAGGCGG - Intergenic
1149460878 17:56829409-56829431 TATGCTGGAGTCCCTGGAAGAGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150069025 17:62137031-62137053 GCTGAAGGAGACACTGCAGGCGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150448588 17:65246601-65246623 GATGAAGGAGGGCCTGGTGGTGG + Intergenic
1151395988 17:73823398-73823420 GATGCAGGAGTCCAAAGAGGAGG + Intergenic
1152257945 17:79251218-79251240 CATGCAGGAGTTCCTGGTGGTGG - Intronic
1152302969 17:79506231-79506253 GAGGAGGGAGTGCCAGGAGGAGG + Intronic
1152343038 17:79735691-79735713 GGGGAGGGAGCCCCTGGAGGTGG - Intronic
1152688559 17:81707192-81707214 GATCAAGGCGGCCCTGGAGGCGG + Exonic
1152720439 17:81921030-81921052 GATGAGGGAGTCACTGTGGGTGG - Exonic
1156479869 18:37429599-37429621 GAAGAAGCAGTCCCTGCATGAGG - Intronic
1157220271 18:45824608-45824630 GTTGAAGGAGTCCCATGAGAAGG + Intergenic
1157270764 18:46274283-46274305 GATGGAGGAGCTCCTGGAGAAGG + Intergenic
1157648178 18:49299443-49299465 GAAGAAGGAGTCTCTGGTGGTGG - Intronic
1157895305 18:51460893-51460915 GATGAAGAAGTTCATGAAGGAGG - Intergenic
1158544257 18:58382260-58382282 GACCAAGGAACCCCTGGAGGTGG + Intronic
1158846842 18:61453162-61453184 GATTAAGGAGTGAGTGGAGGTGG - Intronic
1160725826 19:617431-617453 GCTGAAGGAGACACTGCAGGCGG - Exonic
1161031392 19:2059429-2059451 GAGGCAGGCGTCCCTGGGGGAGG + Intergenic
1161165740 19:2786180-2786202 GAAGGAGGCGTCCCGGGAGGAGG + Intronic
1161379594 19:3958106-3958128 CATGCAGGTGGCCCTGGAGGGGG - Intergenic
1161821568 19:6533617-6533639 GAGGAAGGGGTCTTTGGAGGGGG - Intronic
1161821629 19:6533759-6533781 GGAGAAGGTGTCTCTGGAGGGGG - Intronic
1161821637 19:6533787-6533809 GGGGAAGGGGTCTCTGGAGGGGG - Intronic
1162391586 19:10393324-10393346 CATGAAGGAGTACGAGGAGGAGG - Exonic
1162446225 19:10724537-10724559 GAGGAAGGAACCCCTGGAGACGG + Intronic
1163219183 19:15902385-15902407 GATGAAGGAGACACTGCAGGTGG - Intergenic
1163311437 19:16517262-16517284 CATGGAGGATGCCCTGGAGGAGG + Exonic
1163453815 19:17394283-17394305 GATGGACCAGCCCCTGGAGGGGG - Intergenic
1163512101 19:17741505-17741527 GAAGGAGGACTTCCTGGAGGAGG + Intergenic
1163512158 19:17741709-17741731 GATGGAGGGCTTCCTGGAGGAGG + Intergenic
1163667230 19:18608975-18608997 TATCAGGGAGGCCCTGGAGGAGG - Intronic
1165100716 19:33436970-33436992 GATGGAAGACTTCCTGGAGGAGG + Intronic
1166120117 19:40681272-40681294 GATGAAGGAGGCCCAGGCAGAGG + Intronic
1166959438 19:46488861-46488883 CATGAAGAGGTCCCTGGAGTAGG - Intronic
1167015954 19:46841368-46841390 GATGGAGCAGTAGCTGGAGGCGG - Intronic
1167449894 19:49560852-49560874 GAAGGAGGACTTCCTGGAGGAGG - Intronic
1167569269 19:50276784-50276806 GCTGAAGAAGACTCTGGAGGAGG + Exonic
1167767834 19:51496024-51496046 GAGGCAGGAGTGGCTGGAGGCGG + Intronic
1168136449 19:54355434-54355456 GGTGAGGGAGTGCCTGGTGGAGG + Intronic
1168180506 19:54659658-54659680 AATGAAGGGATGCCTGGAGGTGG - Intronic
1168306624 19:55439396-55439418 GAGGAAAGAGGCCCAGGAGGAGG - Intronic
1168641159 19:58032646-58032668 GATGCTGGACCCCCTGGAGGTGG + Intergenic
925126545 2:1461244-1461266 GAGGAAGGAGCCTCTGGGGGCGG - Intronic
925134265 2:1515396-1515418 CAGGAAGGAGATCCTGGAGGCGG + Intronic
925665679 2:6252728-6252750 GAGAAAGGTGTTCCTGGAGGAGG - Intergenic
925845322 2:8028582-8028604 GAGAAAGGAGATCCTGGAGGCGG - Intergenic
926062593 2:9813623-9813645 GATGGAGGCGTCCCTGGGGAAGG - Intergenic
927125955 2:20012586-20012608 GCAGGAGGAGTCCCGGGAGGCGG + Exonic
927152020 2:20201721-20201743 GAGGAAGCAGCCCCTGGAGACGG + Exonic
927461932 2:23306768-23306790 GATGAAGGAGGGGGTGGAGGTGG + Intergenic
928943634 2:36752664-36752686 AATGTAGGAGACACTGGAGGAGG - Intronic
929600973 2:43204324-43204346 GATGGAGGAGTCACTGCATGGGG - Intergenic
930391137 2:50763043-50763065 GATGAAGAGAGCCCTGGAGGAGG - Intronic
931121457 2:59224898-59224920 GTTGCAGGAGAGCCTGGAGGGGG + Intergenic
932230291 2:70078068-70078090 GAGGCAGGAGACCCGGGAGGCGG + Intergenic
932491721 2:72127054-72127076 GATTGAGGAGCCACTGGAGGAGG + Intergenic
932835452 2:75031568-75031590 GATCAAGCAGTCCCCAGAGGTGG - Intergenic
933178341 2:79201627-79201649 GATCAGGGATTCTCTGGAGGGGG + Intronic
933662771 2:84941299-84941321 GGTGAGTGAGCCCCTGGAGGAGG + Intergenic
933760029 2:85666715-85666737 GATGAGGAAGTTCCTGGAGCAGG - Exonic
934176242 2:89582339-89582361 CCTGAAGGGATCCCTGGAGGGGG - Intergenic
934286552 2:91656700-91656722 CCTGAAGGGATCCCTGGAGGGGG - Intergenic
936489346 2:112957055-112957077 CCTGAAAGAGCCCCTGGAGGTGG - Intergenic
936750448 2:115635113-115635135 GATGACTGAGTTCCGGGAGGAGG - Intronic
937041429 2:118823771-118823793 GTTGAAGGAGTCCCTTCTGGTGG + Intergenic
937432209 2:121848527-121848549 GTCGGAGGAGTCCCTGAAGGTGG - Intergenic
937936402 2:127249160-127249182 AATGGAGGAGCTCCTGGAGGTGG - Intergenic
940460504 2:153958244-153958266 GACTGAGGAGACCCTGGAGGGGG + Intronic
940988295 2:160071982-160072004 GATCAGGGATTCTCTGGAGGGGG + Intergenic
942117294 2:172740678-172740700 CAGAAAGGGGTCCCTGGAGGAGG + Intronic
945098303 2:206240081-206240103 GAGGAAGTAGTTGCTGGAGGAGG - Intergenic
945772666 2:214063686-214063708 GAGGAAGCAGTTCCTGGAAGAGG - Intronic
946213916 2:218168878-218168900 GATGGGGTAGTCCCAGGAGGTGG + Intergenic
946554533 2:220840998-220841020 GATAAAGGAATCCCAGGAGGTGG - Intergenic
947802822 2:232942149-232942171 GATGGGGGACTTCCTGGAGGAGG - Intronic
948242204 2:236447068-236447090 GATGAGAGAGTCACTGGAGGAGG - Intronic
948516973 2:238510166-238510188 TAGAAAGGGGTCCCTGGAGGTGG + Intergenic
949029704 2:241787466-241787488 GATTAGGGAGTCTCTGGAGGGGG - Intronic
1168908521 20:1426429-1426451 GTTGACTGAGTCCCTGGAGGTGG - Intergenic
1170854873 20:20042731-20042753 GATGAAGGAGTCCTTGCTGTGGG - Intronic
1172178288 20:32985739-32985761 GATGACGAAGTCCTTGGGGGCGG + Exonic
1172194686 20:33083792-33083814 GATGGAGGACTTCTTGGAGGAGG + Exonic
1173404363 20:42752177-42752199 GATGAAGGACTCCATGGGTGGGG - Intronic
1174588968 20:51630145-51630167 GCTGGAGGAGTTCCTGGTGGTGG - Intronic
1175573090 20:60038879-60038901 GCTGAATGAGCCTCTGGAGGTGG - Intergenic
1176070093 20:63221780-63221802 GCTGAAGGTGTCCACGGAGGCGG - Intergenic
1176307911 21:5133917-5133939 GGTGCAGGAGGCCCTGGAGGCGG - Exonic
1176964820 21:15200408-15200430 GATGAAGGAGTCAGTGCAGAGGG + Intergenic
1178664442 21:34534227-34534249 GCAGAGGGGGTCCCTGGAGGAGG - Intronic
1179849150 21:44128113-44128135 GGTGCAGGAGGCCCTGGAGGCGG + Exonic
1180256619 21:46634289-46634311 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1180568776 22:16697261-16697283 GAGCAAGGAGTTCATGGAGGAGG - Intergenic
1181080572 22:20412089-20412111 GATTTGGGACTCCCTGGAGGAGG + Intergenic
1181108970 22:20590421-20590443 CAGGAAGGAATCCCTGGATGGGG + Intergenic
1181111267 22:20604345-20604367 GATGGACGAGTGCCTGGAGGAGG - Intergenic
1181271656 22:21662139-21662161 GATGGAGGACTGCCTGGAGGTGG + Intronic
1181601201 22:23952850-23952872 GAGGGAAGACTCCCTGGAGGAGG + Intergenic
1181886093 22:26023527-26023549 GGTGAAGAAGTCCCAGGAGGAGG - Intronic
1182054247 22:27337539-27337561 GATGAAAAAGTCCCTGGTGATGG - Intergenic
1182321203 22:29479549-29479571 GATGAAGGGGGACCTGGAGTTGG - Intergenic
1183096026 22:35552835-35552857 GAGGAAGGCGTCCCGGGTGGAGG - Exonic
1183186595 22:36295027-36295049 CCTGAAGAAGACCCTGGAGGAGG - Exonic
1183322965 22:37176330-37176352 GAGGAAGGAGTCATTGGAGAGGG - Intergenic
1183743272 22:39679754-39679776 CATCAAGGACTCCTTGGAGGGGG + Exonic
1184309414 22:43631545-43631567 TAAGGAGGACTCCCTGGAGGAGG - Intronic
1184470265 22:44692164-44692186 GGTGGAGGAGCCCCGGGAGGAGG - Intronic
1184470283 22:44692208-44692230 GGTGGAGGAGCCCCTGGTGGAGG - Intronic
1184470346 22:44692370-44692392 GGTGGAGGAGCCCCGGGAGGAGG - Intronic
1184470371 22:44692433-44692455 GGTGGAGGAGCCCCAGGAGGAGG - Intronic
1185118186 22:48949900-48949922 GAGGAAGAGGTCCCTGGGGGAGG - Intergenic
1185405338 22:50645004-50645026 CATGAAGGAGTCCAGGGAGCAGG - Intergenic
1185412891 22:50695198-50695220 GAAGAAGGCATCTCTGGAGGTGG + Intergenic
950230629 3:11272576-11272598 AATCAGTGAGTCCCTGGAGGAGG - Intronic
950600692 3:14032793-14032815 GATCAGGGATTCTCTGGAGGGGG + Intronic
951708729 3:25568801-25568823 GAACATGGACTCCCTGGAGGGGG + Intronic
952644088 3:35635514-35635536 GTTGAAGCAGGTCCTGGAGGGGG + Intergenic
952701662 3:36335345-36335367 GAGGAAGGATTCCCAGGTGGGGG - Intergenic
953230761 3:41062971-41062993 GAAGAAGGAATCCCTGTGGGTGG + Intergenic
953680317 3:45034105-45034127 GCTGAGGCAGTCCCTGCAGGAGG + Intronic
953684339 3:45064608-45064630 GAGGAAGGTGTCCGTGGGGGAGG + Intergenic
954297250 3:49681142-49681164 GTTGTGGGTGTCCCTGGAGGAGG + Exonic
954398489 3:50306154-50306176 AATCAAGGATTCTCTGGAGGGGG - Intronic
954690249 3:52391872-52391894 AGAGAAGGGGTCCCTGGAGGAGG - Intronic
955416325 3:58695465-58695487 GATCAGGGATTCCCTGAAGGGGG + Intergenic
955421681 3:58744547-58744569 GATGAGAGAGTCCCTGGGGGAGG + Intronic
957669966 3:83288598-83288620 GATCAAGGATTTTCTGGAGGAGG - Intergenic
957940499 3:86996985-86997007 GGTGAAGGAGACGCTGGAAGAGG + Intergenic
959557424 3:107738119-107738141 CATGAAGGACTTCCTGGAGGAGG - Intronic
961326945 3:126114616-126114638 GAAGAAGGTGTCCCTGGAACTGG - Exonic
961371359 3:126433885-126433907 GGTGCAGGGTTCCCTGGAGGAGG + Intronic
961568618 3:127782566-127782588 GAGGAAGCAGGCCCTGGTGGAGG - Intronic
961658667 3:128457003-128457025 GGAGATGGAGCCCCTGGAGGGGG - Intergenic
962258958 3:133891077-133891099 GATGAAGGGCTCCCTGCAGGAGG + Intronic
962313713 3:134344744-134344766 GATGAGGAAGTCCCTCCAGGTGG - Intergenic
962921676 3:139955871-139955893 AAAGATGGAGTCCCTGGAGAGGG + Intronic
963266194 3:143242494-143242516 AATGTAGCAGGCCCTGGAGGTGG - Intergenic
963826994 3:149966544-149966566 AAAGAAGGGGTCCATGGAGGCGG - Exonic
963896366 3:150689126-150689148 GATCAGGGATTCTCTGGAGGGGG - Intronic
964611757 3:158622845-158622867 GATTAGGGATTCTCTGGAGGGGG + Intergenic
964689805 3:159437589-159437611 GAGGAAGGAGACGGTGGAGGGGG + Intronic
965423117 3:168487343-168487365 GAAGAAGGAGGACCTGGATGTGG - Intergenic
965867721 3:173225819-173225841 GATGGTGGAGTGCCTGGAGAGGG - Intergenic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966068771 3:175848968-175848990 TGTGAAGGAGTCCATGGAAGAGG - Intergenic
966750050 3:183313326-183313348 GCAGAAGGAGACACTGGAGGGGG + Intronic
966882435 3:184357922-184357944 AATGAAGGAGTCCCTCCTGGTGG - Intronic
967111548 3:186298178-186298200 CATGAGGGCGTACCTGGAGGTGG - Exonic
967806609 3:193719710-193719732 CAGGAAGGATGCCCTGGAGGTGG + Intergenic
967814922 3:193790477-193790499 CAGGGAGGAGTTCCTGGAGGTGG + Intergenic
968316935 3:197732815-197732837 GATGAAGGAGCCACTGAAAGAGG + Intronic
968807161 4:2781778-2781800 GATGAGGGATTCTCTGGAGGGGG + Intergenic
968965077 4:3765702-3765724 GCTGCAGGCGGCCCTGGAGGGGG + Intergenic
969133638 4:5012068-5012090 GAAGAAGGAGTCCAGGGTGGCGG + Intergenic
969446363 4:7246943-7246965 AAGGAAGGGGACCCTGGAGGAGG - Intronic
970352636 4:15218341-15218363 GGTGGAGGAGTCTCTGAAGGAGG + Intergenic
972288807 4:37672022-37672044 GAGGATGGTGTGCCTGGAGGGGG - Intronic
972874256 4:43338989-43339011 GATGAAGGCTGTCCTGGAGGTGG + Intergenic
973284797 4:48403349-48403371 GATGATGGAGCCCCTGGAGGAGG - Intronic
975573158 4:75838138-75838160 GATCAGGGATTCTCTGGAGGGGG - Intergenic
977042953 4:92037294-92037316 GATCAGGGATTCTCTGGAGGAGG + Intergenic
977308995 4:95361222-95361244 GATAAAATAGTCCCTGCAGGAGG - Intronic
977354234 4:95925507-95925529 GATCAAGGATTCTCTGGTGGAGG - Intergenic
979174204 4:117641889-117641911 GATGAAGCAGTCCCTGACGCAGG - Intergenic
980270224 4:130574566-130574588 GATCAGGGATTCTCTGGAGGGGG + Intergenic
981071475 4:140544982-140545004 AATGAAGCAGTATCTGGAGGTGG - Intronic
983143860 4:164188383-164188405 GATGAAGCTCTCCCTGGTGGCGG + Intronic
984386624 4:179067909-179067931 GATGAAGCAGGACCTGGAAGGGG + Intergenic
984962790 4:185113823-185113845 GATCAAGGTGTCACTGGAGTTGG - Intergenic
985826475 5:2195398-2195420 GATGCAGGGGTCCCTTGTGGAGG - Intergenic
988480567 5:31627018-31627040 GAGGAAGGAGTACCTGCAGAGGG + Intergenic
990893787 5:60675391-60675413 GATTTTGGAGTCCCTGGAGCTGG - Intronic
993792661 5:92225566-92225588 GAAGAAGGAGTCCCCGGCGAAGG + Intergenic
995464225 5:112434733-112434755 GTTCAAGGAGTTCGTGGAGGTGG - Intergenic
997455920 5:134017367-134017389 GAGGCAGGAGAACCTGGAGGTGG + Intergenic
997583925 5:135033867-135033889 CTTGAAGGCGTCCATGGAGGTGG + Exonic
997835922 5:137193422-137193444 GGTGATGGAGGCCCTGGAGCAGG + Intronic
998038249 5:138934526-138934548 TAGGAAGCAGTCCCTGGAGAAGG + Exonic
1000097850 5:157986818-157986840 CATGAAGGAGTACGAGGAGGAGG - Intergenic
1000275675 5:159732862-159732884 GATGAATGAGTCCCTTGGGAAGG - Intergenic
1001047395 5:168385266-168385288 GCTGAAGGATTACCTGGTGGTGG + Exonic
1001535442 5:172494798-172494820 CAGGAAGGACTTCCTGGAGGAGG + Intergenic
1001719895 5:173848234-173848256 GATGAGGAAGTTTCTGGAGGAGG + Intergenic
1002703456 5:181143594-181143616 GATCAGGGATTCTCTGGAGGAGG - Intergenic
1003072658 6:2957228-2957250 GATGCAGGAGTTCCCGGGGGAGG - Intronic
1003256113 6:4476388-4476410 GATGAAGCAGTGGCTGAAGGGGG - Intergenic
1003607754 6:7580114-7580136 GCACAAGCAGTCCCTGGAGGAGG + Exonic
1007202164 6:40118885-40118907 TATGAAGCAGTGCCTGAAGGGGG + Intergenic
1007387467 6:41529417-41529439 TCTGAGGGAGTCCCCGGAGGGGG - Intergenic
1007695728 6:43733331-43733353 GTACAATGAGTCCCTGGAGGAGG - Intergenic
1007725606 6:43913945-43913967 CAGGAGGGAGTCCCTGGAGCAGG + Intergenic
1011571115 6:88736988-88737010 GAGGCAGGAGTCTATGGAGGTGG + Intronic
1012075063 6:94672747-94672769 TGTGAAGGAGCCCCTGGGGGAGG + Intergenic
1015814302 6:137192329-137192351 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1016194807 6:141321823-141321845 CATCAACGAGTCCCTGGAGTAGG + Intergenic
1017027823 6:150197195-150197217 GATGAGGGAGTCTGTGGAAGAGG + Intronic
1017646442 6:156543649-156543671 CATAAAGGAGTCCCTGGGGCTGG - Intergenic
1018632901 6:165835714-165835736 GAACAGGGAGTCCCTGGAGCTGG + Intronic
1018954231 6:168397256-168397278 GCTGGAAGGGTCCCTGGAGGAGG - Intergenic
1019307475 7:342761-342783 CAGGAAGGAGGCCCTGGAGCAGG + Intergenic
1022704824 7:32792502-32792524 TATGAAAGTATCCCTGGAGGTGG + Intergenic
1023058245 7:36306743-36306765 GTTGCAGAAGACCCTGGAGGTGG - Intergenic
1023137339 7:37065502-37065524 CATGAAGGAGTGACTTGAGGGGG - Intronic
1023993862 7:45146722-45146744 AAGTAAGGAGTCCCTGCAGGGGG + Intergenic
1027049056 7:75010191-75010213 CATGGAGGACTTCCTGGAGGAGG + Intronic
1028744058 7:94307587-94307609 AATGAAGAAGAACCTGGAGGAGG - Intergenic
1029188345 7:98755073-98755095 GAGGATGGAGTTCCTGCAGGAGG + Intergenic
1029189100 7:98759445-98759467 GATGAAGAGGTCCCTTGGGGTGG + Intergenic
1029383962 7:100231468-100231490 CATGGAGGACTTCCTGGAGGAGG - Intronic
1029483074 7:100824508-100824530 GATCTAGGCCTCCCTGGAGGAGG + Intronic
1029514929 7:101018356-101018378 GAGGAGGGAGTCCCAGGAGAAGG - Intronic
1031991671 7:128202787-128202809 GAGGAAGGAATTTCTGGAGGAGG + Intergenic
1032472011 7:132185387-132185409 GATGAAGGTGTCGGTGCAGGTGG - Exonic
1032513050 7:132487203-132487225 GATGGAGTAGACCCTGGATGAGG - Intronic
1034343961 7:150374473-150374495 GATGAAGGAGCCTCTGGGAGGGG + Intronic
1035063847 7:156091249-156091271 TCTGAAGGGGCCCCTGGAGGAGG - Intergenic
1035789273 8:2289060-2289082 GAAGAAGGACTTCCTGGAGGAGG - Intergenic
1035803532 8:2432645-2432667 GAAGAAGGACTTCCTGGAGGAGG + Intergenic
1037315359 8:17595187-17595209 GAGGGCGGAGTCCCTGGAGGTGG - Intronic
1037581909 8:20250300-20250322 GCTGAAGGAGTCCCAGACGGAGG - Exonic
1038021038 8:23551972-23551994 GATCCTGGAGTCCCAGGAGGAGG - Intronic
1038024403 8:23576005-23576027 AATGCAGGGGTGCCTGGAGGTGG + Intergenic
1039453633 8:37694876-37694898 GAGGCGGGTGTCCCTGGAGGGGG - Intergenic
1039854765 8:41402737-41402759 GAGAAAGGTGTCCTTGGAGGAGG - Intergenic
1040418638 8:47219058-47219080 AATGTGGGAGTCCCTGGGGGAGG + Intergenic
1042186458 8:66140931-66140953 AATGAAGTAGTCCCTGGGGTGGG + Intronic
1042201259 8:66281226-66281248 CATGAAGGAACCCCTGGAGAAGG - Intergenic
1044950891 8:97434371-97434393 GATGTAGGACTCCCTGCAGCTGG + Intergenic
1045052617 8:98340787-98340809 CATGGAGGAGGCCCTGGAAGTGG + Intergenic
1046221948 8:111228066-111228088 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1048881526 8:138876294-138876316 GATGGAGGGCTCCCTGGAGGAGG - Intronic
1049199705 8:141334083-141334105 CAGGAAGGACTTCCTGGAGGAGG + Intergenic
1053079284 9:35161294-35161316 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1053199579 9:36143354-36143376 AAAGGAGGACTCCCTGGAGGAGG - Intronic
1055527865 9:77153474-77153496 CAGGAAGGACTTCCTGGAGGAGG - Intergenic
1056183401 9:84107668-84107690 GAGGGAAGAGTTCCTGGAGGAGG + Intergenic
1057278784 9:93695564-93695586 GATGAGGGAGTCTTTGGAGATGG + Intergenic
1058464344 9:105213075-105213097 CAAGAAGCAGTCACTGGAGGGGG - Intergenic
1059002874 9:110368151-110368173 GATGGAGGAGACCCTGGAAGAGG + Intronic
1060209897 9:121703212-121703234 GGTGAGACAGTCCCTGGAGGAGG + Intronic
1062035577 9:134381155-134381177 GTTGAGGGAGGCCCTGGAGAGGG + Intronic
1185466733 X:359213-359235 GATGAAGGTGTCCCAGCAGACGG + Intronic
1186516858 X:10172951-10172973 GGAGCAGGAGACCCTGGAGGAGG + Intronic
1186812675 X:13205787-13205809 GAGGAAGGAGTTCATAGAGGTGG + Intergenic
1187616178 X:20995777-20995799 GATGAGGGATTCTCTGGAGGGGG - Intergenic
1187816176 X:23234587-23234609 GATCAGGGATTCTCTGGAGGGGG - Intergenic
1188876916 X:35441654-35441676 GATGATGGATTCTCTGGAAGTGG + Intergenic
1189412746 X:40788361-40788383 TATGAGGGGGTCTCTGGAGGAGG + Intergenic
1189724541 X:43954990-43955012 GAGGAAGGAGGGGCTGGAGGGGG - Intronic
1189890540 X:45597544-45597566 GCTGAGGGAGCCCCTGAAGGTGG + Intergenic
1190260709 X:48795179-48795201 GACAAAGCAGCCCCTGGAGGTGG + Intergenic
1190339701 X:49286673-49286695 GGTGACTGAGTCCCTGGGGGAGG + Exonic
1190908460 X:54750727-54750749 CAAGAAGGACTTCCTGGAGGAGG - Intronic
1190956569 X:55200882-55200904 GATGAGGGATTCTCTGGAGATGG + Intronic
1191192208 X:57679177-57679199 GGTGGAGGAGTTCCTGGAGAAGG - Intergenic
1191602006 X:63018564-63018586 GATGAAGGACCCACTTGAGGAGG - Intergenic
1191779075 X:64847455-64847477 GATGAAGGAGTAGGTAGAGGGGG - Intergenic
1193359263 X:80561441-80561463 AATGGAGGAGCTCCTGGAGGTGG - Intergenic
1194166595 X:90523401-90523423 GATAAGGGATTCTCTGGAGGGGG - Intergenic
1194534027 X:95084254-95084276 GATCAAGGATTCTCTGGAGGGGG + Intergenic
1195220609 X:102742613-102742635 GATCAGGGATTCTCTGGAGGGGG + Intronic
1196382747 X:115109840-115109862 GATCAGGGATTCTCTGGAGGGGG + Intergenic
1196413478 X:115445256-115445278 TATGAAGGAGTCCCATGAGGGGG + Intergenic
1196726716 X:118902284-118902306 GCTGATGCAGTCCCTGGAGCAGG - Intergenic
1197262350 X:124332753-124332775 GAGGAAGGAGGCCAAGGAGGAGG + Intronic
1197344971 X:125319955-125319977 GAGGAAGGAGGCCAAGGAGGAGG + Intergenic
1199541039 X:148958366-148958388 GAAGAAGCAGCGCCTGGAGGAGG + Exonic
1200512862 Y:4101183-4101205 GATAAGGGATTCTCTGGAGGGGG - Intergenic
1200775203 Y:7164425-7164447 GAGGAAGGAGGAGCTGGAGGAGG - Intergenic