ID: 966056684

View in Genome Browser
Species Human (GRCh38)
Location 3:175701419-175701441
Sequence CTGAATATACAAATTGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 21, 3: 61, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966056684_966056686 4 Left 966056684 3:175701419-175701441 CCATCGTCAATTTGTATATTCAG 0: 1
1: 0
2: 21
3: 61
4: 215
Right 966056686 3:175701446-175701468 TCACGATAGACCCAGGTCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 71
966056684_966056685 -3 Left 966056684 3:175701419-175701441 CCATCGTCAATTTGTATATTCAG 0: 1
1: 0
2: 21
3: 61
4: 215
Right 966056685 3:175701439-175701461 CAGTGTCTCACGATAGACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966056684 Original CRISPR CTGAATATACAAATTGACGA TGG (reversed) Intronic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
910195778 1:84638274-84638296 GTGAATATCCAAATTACCGATGG + Intergenic
910552513 1:88492134-88492156 CTGATTAGAGAAATAGACGAAGG + Intergenic
911992433 1:104718191-104718213 CTGAACATACAAATTTCCCAGGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914450724 1:147789051-147789073 CTGAAGATTCAAATTCAAGAAGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915582847 1:156825589-156825611 CTGAATATACAAGGTAATGATGG - Intronic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918251712 1:182708840-182708862 CTGAATGTCCAAGTTGACGCTGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922006785 1:221539228-221539250 TTTAATATACAAATTGTGGAGGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069146697 10:64901645-64901667 CTGAATATAGATATTTACGCTGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071690975 10:87818958-87818980 CTGAATACACAAACTGCCGGTGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1080944469 11:36956040-36956062 CTGAATATACAATTTGAAATAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1084838298 11:71822533-71822555 CAGAAAATACAAAATGACGTAGG + Intergenic
1085560825 11:77472173-77472195 CTGAATAAGCAAATTTACCAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1091576280 12:1739178-1739200 CTGAACATAAAAAATGATGAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107254470 13:38407165-38407187 CTGAGTCTACAAATTGAAGCAGG + Intergenic
1107404837 13:40102753-40102775 GTGAATAAACAAATTCACTAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108205978 13:48090927-48090949 ATTAATATACAAATTGTCTATGG + Intronic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110297233 13:73882080-73882102 TTGAAAATACAAAGTGAGGAGGG + Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116257831 14:42580115-42580137 CAGAATATATAAATTTATGAGGG + Intergenic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1120260426 14:82177677-82177699 CTGGATATAGAAATTGTGGATGG - Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124606965 15:31176672-31176694 CTGAATTTAAAATGTGACGAGGG + Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131956876 15:97746327-97746349 CTGATTACACAAATTAACTAGGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137950282 16:52777011-52777033 CTTAATATAAATATTGAGGAGGG + Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144087551 17:11824323-11824345 CTGAATCAAGAAATTGAAGAGGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157232567 18:45932554-45932576 CTAAATATAAAAAGTGAGGAAGG + Intronic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1158837077 18:61342357-61342379 CTGCATCTACAAAGTGAAGATGG - Intronic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159849581 18:73511608-73511630 CTGAATATAGTACTTGATGAGGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926449826 2:12989121-12989143 CTAAAAATTCAAATTGATGAAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928975017 2:37077467-37077489 CTGAATATACAAAATGAGCTGGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930463447 2:51713287-51713309 CTGAATCTATAAATTGATTAGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938999507 2:136717777-136717799 CTGAATATTCCAATAGATGATGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941871599 2:170391407-170391429 CTGAAAATACAAATTTGCCATGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941988176 2:171528649-171528671 CTGAATATACAAATTTGAGAGGG - Intronic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
943299844 2:186184541-186184563 CTGAAATTACAAATTTACTATGG + Intergenic
943714628 2:191137038-191137060 CTGATTAAAAAAATTGAAGAGGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945592615 2:211753358-211753380 CTTAATACACAAAATGAAGAAGG - Intronic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169841832 20:9946612-9946634 ATGAAAATACAACTTGAAGAAGG + Intergenic
1170509699 20:17063999-17064021 CTAAAGACACAAATTGAAGAAGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171515858 20:25734459-25734481 CTAAATAAACAGAGTGACGAGGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1184909884 22:47523925-47523947 ATTAATATACAAAATGCCGAAGG + Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953016859 3:39085606-39085628 CTGAATATAAAAACTAACCATGG - Exonic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961959717 3:130842402-130842424 GTGAATATACAAGGTGAAGATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964898346 3:161625623-161625645 CTGAATATATAAGTTGAAGAAGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
975512776 4:75211710-75211732 CTAAATGTAGAAATTGAGGAGGG - Intergenic
976256408 4:83105146-83105168 CTGAATAGAAACATTGAAGATGG - Intronic
976568961 4:86586453-86586475 CTGCAAATTCAAATTAACGAAGG - Intronic
976742706 4:88373502-88373524 CTGATTAAAGAAATTGAAGAGGG + Intergenic
978407210 4:108392902-108392924 CAGAGTATTCAAATTGAAGAAGG - Intergenic
978454590 4:108874373-108874395 CTGAGTAGACAAAGTGACGGAGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
980209861 4:129773172-129773194 TTGAATATACAAGTTGGGGACGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981744859 4:148042913-148042935 CTGCCTCTACAAATTGAGGAGGG - Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
981888748 4:149711919-149711941 CTGAATATACTTAGTGAAGATGG - Intergenic
982833884 4:160098242-160098264 CTGGATATAACAATTGAGGATGG - Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
983869201 4:172805209-172805231 CTGACTATGCAAATTGCTGAAGG + Intronic
984435047 4:179699146-179699168 ATGAACATGCAAATTGACTAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
993959184 5:94275883-94275905 CTGATTAAACAAATTAACTATGG + Intronic
994746007 5:103679259-103679281 CTCCATATAAAAATTGAAGAAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000222713 5:159229141-159229163 CTGAGGATACAAATTGACTCTGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1004233028 6:13850032-13850054 CTGAATATATAAACAGATGATGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004572609 6:16862467-16862489 CTGAAGATACTAATTGACCCTGG + Intergenic
1004781470 6:18913278-18913300 GTGAATTGACAAATTGATGAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006861866 6:37177154-37177176 CTTAATATATGAATTGACAATGG - Intergenic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008425994 6:51357347-51357369 CTGAATAGTCAAAATGATGATGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009026169 6:58002929-58002951 CTTAATATACAAATTTTAGAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011669499 6:89669548-89669570 ATGAATTTACAAACTGAAGATGG - Intronic
1012133859 6:95530974-95530996 CTGTATATAAGAATTGAGGAGGG - Intergenic
1012997878 6:105992057-105992079 CTGAAAAAACAAACTCACGATGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013964621 6:115939903-115939925 CTGAATATATAAATTGCCTTGGG - Exonic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020686796 7:11306543-11306565 CTGAATATAGAACTAGAAGAAGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1030862193 7:114647529-114647551 CAGAAAATACAAAATGATGAAGG + Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038825561 8:30996241-30996263 CTGAATTTAAAAATTGAGGGGGG - Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040606417 8:48936507-48936529 CTAAATATACACACTGACCATGG - Intergenic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1040969542 8:53119584-53119606 CTGCAAATACAACTTGACTATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041808503 8:61882008-61882030 ATGAATAGACACATTGAAGAGGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043803973 8:84647433-84647455 CTGAAGATAGAAATTGGAGAAGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1048175149 8:132145224-132145246 CTGTATATACAAGTTGAACATGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051042969 9:12836813-12836835 CTGAATATACAAATACACTCTGG + Intergenic
1051798889 9:20908628-20908650 CTGAAGATAAAAATTGAGTAAGG - Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056973974 9:91233606-91233628 CTGAATATACACATTGTTTATGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186042037 X:5491255-5491277 CTGGAAATAGAAATTGGCGAGGG - Intergenic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1188303902 X:28539067-28539089 CTCAATATAGAAATTGTAGAAGG + Intergenic
1188404765 X:29794370-29794392 CTGAATATCCAAATTGGCCTAGG - Intronic
1188905892 X:35791358-35791380 TTGAATATACAAATTTTCTATGG - Intergenic
1189114913 X:38332269-38332291 CTAAATATACAAATTTATGTTGG - Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1192241187 X:69330364-69330386 CTGATTAAAAAAATTGAAGAGGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193227106 X:78997089-78997111 CTGAATATCCAAAATAAAGATGG + Intergenic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1196090873 X:111740909-111740931 CTGAATAGCCAAATAGATGAGGG + Intronic
1196681589 X:118475194-118475216 CTGAAAATACAAAATGTAGATGG + Intergenic
1199106275 X:143873035-143873057 TAGAATAGACAAATTGAAGAGGG + Intergenic
1200640688 Y:5713317-5713339 CTTAATTTACAATTTGACCATGG - Intronic
1200930701 Y:8694414-8694436 GTGAAGATACAAACTGATGAAGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic