ID: 966060775

View in Genome Browser
Species Human (GRCh38)
Location 3:175751852-175751874
Sequence GTTTTTATGGGGTTTTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 736}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966060770_966060775 5 Left 966060770 3:175751824-175751846 CCTTAAGTAAAGTTTTATATAAT 0: 1
1: 0
2: 0
3: 62
4: 637
Right 966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG 0: 1
1: 0
2: 0
3: 59
4: 736
966060769_966060775 10 Left 966060769 3:175751819-175751841 CCGTGCCTTAAGTAAAGTTTTAT 0: 1
1: 1
2: 5
3: 39
4: 406
Right 966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG 0: 1
1: 0
2: 0
3: 59
4: 736
966060768_966060775 30 Left 966060768 3:175751799-175751821 CCTCTTTTCTCTGAAATTCACCG 0: 1
1: 0
2: 0
3: 18
4: 252
Right 966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG 0: 1
1: 0
2: 0
3: 59
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966060775 Original CRISPR GTTTTTATGGGGTTTTTGTA GGG Intronic
900084617 1:885878-885900 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
901641079 1:10693579-10693601 GGATTTAGGGGGTTTTTGTGGGG - Intronic
901889182 1:12247500-12247522 GTTTTTTTTGGGTTTTTTTTGGG - Intronic
902737305 1:18409579-18409601 GATTTCATGAGGTTCTTGTAAGG + Intergenic
903563963 1:24250343-24250365 TATTTTATGAGGTTTTTTTAAGG - Intergenic
904148053 1:28411046-28411068 GTTTTTTGGGGGTTTTTTTGAGG + Intronic
904266566 1:29321704-29321726 GTTCTTGTGGGGTTATTGTGAGG + Intronic
904542951 1:31245902-31245924 GTTTTTTTGGGTTTTTTTTTAGG - Intergenic
905152495 1:35942350-35942372 TTTTTTATAGTGTTTTTGTCAGG + Intronic
906292053 1:44625775-44625797 GTTTTGCTGGGGTTTTTGCTGGG + Intronic
906295781 1:44648293-44648315 AATCTTATGGGGTTTTTGTAAGG + Intronic
906933235 1:50189617-50189639 GTTTTTTGGGGGTTTTTTTCCGG + Intronic
908353892 1:63313106-63313128 TTCCTTATGGGGTTTTTGTAAGG - Intergenic
908406248 1:63816801-63816823 TGTTTTATGGGCTTTTTGTAAGG + Intronic
908461033 1:64348458-64348480 GTTTGTAGGGGGTGTGTGTATGG + Intergenic
908567407 1:65371395-65371417 TTTTTTATAGGTTTGTTGTAAGG + Intronic
909493022 1:76246971-76246993 CTTTGGATGGGGTTTTTGTGTGG + Intronic
909590368 1:77341866-77341888 GTTTTGTTGGGGTTATTGTTTGG + Intronic
909613873 1:77584286-77584308 GCTTTTATTGGATATTTGTATGG - Intronic
909677927 1:78258118-78258140 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
910499060 1:87867887-87867909 GTTTTTCAGTGGTTTTTCTAGGG - Intergenic
911245770 1:95515425-95515447 TTTATTATGGGGTGTTTGTGGGG - Intergenic
911308135 1:96257166-96257188 TTTTTTAGGAGGTTTTTGGAGGG - Intergenic
911614567 1:99995070-99995092 ATTTTTATGGGGTTTTTTTTTGG + Intronic
911674968 1:100648074-100648096 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
911938475 1:104011343-104011365 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
912133249 1:106627915-106627937 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
912235449 1:107845271-107845293 CTTTGAATGGGGTTTTTGTGTGG - Intronic
912297436 1:108484190-108484212 GTTTTTGTGTGGTTTTGGGAGGG - Intergenic
912371079 1:109174539-109174561 GTTTTTATGGGGTTTACATTCGG + Intronic
912581192 1:110722494-110722516 ATGTGTATGGGGTGTTTGTAGGG + Intergenic
912602463 1:110950838-110950860 GGTTTTGTGGGGTTTTTTTGTGG - Intronic
912990495 1:114481588-114481610 GTTTTTCTTGGGTTTTTTTTCGG - Intronic
913268905 1:117073262-117073284 GTTGTTTTGGGGTTTTTTTTGGG + Intronic
913541280 1:119822982-119823004 GTTATTATGGGTTTTTTGATGGG + Intergenic
913560812 1:120017559-120017581 GTATTTATAGGGTCTTTTTAAGG - Intronic
913637315 1:120776043-120776065 GTATTTATAGGGTCTTTTTAAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913961721 1:143343747-143343769 GTCTTTATGAGGTCTTTGAAAGG - Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914056076 1:144169319-144169341 GTCTTTATGAGGTCTTTGAAAGG - Intergenic
914123070 1:144797043-144797065 GTCTTTATGAGGTCTTTGAAAGG + Intergenic
914218380 1:145655467-145655489 CTTTGGATGGGGTTTTTGTGGGG + Intronic
914281395 1:146176972-146176994 GTATTTATAGGGTCTTTTTAAGG - Intronic
914399515 1:147304796-147304818 CTTTGGATGGGGTTTTTGCATGG - Intergenic
914470941 1:147978158-147978180 CTTTGGATGGGGTTTTTGTGGGG + Intronic
914542440 1:148627907-148627929 GTATTTATAGGGTCTTTTTAAGG - Intronic
914624193 1:149443336-149443358 GTATTTATAGGGTCTTTTTAAGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914848952 1:151299875-151299897 GTTTTTATGTTGTTTTTTAAAGG + Intronic
914969340 1:152292802-152292824 CTTTGGATGGGGTTTTTGCACGG - Intergenic
915794612 1:158715764-158715786 GTTTTTAGGGGTTTTTTTTAGGG + Intergenic
915846336 1:159269531-159269553 TTTTGGATGGGGTTTTTGTGTGG - Intergenic
916612704 1:166409093-166409115 CTTTGGATGGGGTTTTTGCATGG + Intergenic
916916208 1:169408860-169408882 CTTTGGATGGGGTTTTTGTGTGG - Intronic
916985835 1:170190979-170191001 CTTTAGATGGGGTTTTTGTGGGG + Intergenic
917023267 1:170613696-170613718 TTTTGGATGGGGTTTTTGTGTGG + Intergenic
917063250 1:171063899-171063921 GTCTATGTGGGGTTTTAGTAGGG + Intronic
917123164 1:171662033-171662055 GCTTTTATGGGTTTTTTTTCTGG + Intergenic
917274744 1:173319827-173319849 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
917879191 1:179317043-179317065 GTTTTTATGGTTTGTTTTTAAGG + Intronic
918353661 1:183684335-183684357 CTTTGGATGGGGTTTTTGTGTGG + Intronic
918486469 1:185034229-185034251 GGTTTTTTGGGGTTTTTTTTTGG - Intergenic
918614697 1:186531331-186531353 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
918787842 1:188787893-188787915 GTTTTCATGGATTTCTTGTATGG + Intergenic
918857290 1:189773989-189774011 GTTTTTAGATGGTTTTTGTTAGG - Intergenic
919123672 1:193371123-193371145 GGTTTTTGGGGGTTTTTGTTAGG - Intergenic
919146665 1:193644560-193644582 CTTTGGATGGGGTTTTTGCATGG + Intergenic
921567517 1:216737892-216737914 GTTTTTGTGGGCTGTATGTAAGG - Intronic
921738183 1:218652936-218652958 CTTTGGATGGGGTTTTTGCATGG + Intergenic
921918797 1:220642928-220642950 CTTTGGATGGGGTTTTTGTGGGG - Intronic
922084304 1:222331286-222331308 TATTTTATGGGGTTGTTGTGAGG - Intergenic
922189712 1:223307391-223307413 GATCTCATGGGGTTGTTGTATGG - Intronic
922679240 1:227577900-227577922 TTTTTTCAGGAGTTTTTGTAAGG + Intronic
923235452 1:232028619-232028641 GTTTTTATGGGGGTTAAATAAGG + Intronic
923553012 1:234979236-234979258 ATTTTTATGGGGTTTTTATTTGG + Intergenic
923588741 1:235300025-235300047 GTTTTTCTGGGTTTCTTTTATGG - Intronic
924004099 1:239588077-239588099 GTTTTTATGCAGTATTTGCATGG - Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924377363 1:243426893-243426915 GATTTTATATGCTTTTTGTAAGG + Intronic
924493886 1:244568008-244568030 CTTTACATGGGGTTTTTGTGTGG + Intronic
1062761896 10:28731-28753 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
1063338104 10:5235745-5235767 TTTTGGATGGGGTTTTTGTGTGG - Intergenic
1063523591 10:6762631-6762653 GTTATTATGGGGCTGTTGTTAGG + Intergenic
1063704030 10:8413349-8413371 GGTTTTTTGGGTTTTTTGTGTGG - Intergenic
1064848340 10:19681827-19681849 CTTTGGATGGGGTTTTTGTGGGG + Intronic
1065034091 10:21620517-21620539 CTTATGATGGGGTTATTGTAAGG + Intronic
1065120511 10:22525712-22525734 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1065522578 10:26586754-26586776 GTTTCTATGAGGCTTTTATAAGG + Intergenic
1066463227 10:35630725-35630747 TATTTTATAGGGTTGTTGTAAGG - Intergenic
1066577633 10:36843843-36843865 GCCTTTATGGGGTATTTTTAAGG + Intergenic
1067977955 10:51047333-51047355 GTACTTATGAGGTTTTTGTGAGG + Intronic
1068109416 10:52661679-52661701 TATTTTATAGGGTTTTTGTGCGG - Intergenic
1068564785 10:58562726-58562748 GATTTTATGTAGTTTTTGTAAGG + Intronic
1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG + Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069360291 10:67633706-67633728 CTTTTAATGGGGTTTTTATGGGG - Intronic
1070213280 10:74348408-74348430 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1070216819 10:74392888-74392910 GTTTTGCTGGGATTTTTGAATGG + Intronic
1070691948 10:78533529-78533551 GGTTTTATTGTGTTTTTATATGG + Intergenic
1071188689 10:83075981-83076003 CTTGTTATGGGGTTTTTGTTGGG - Intergenic
1071975753 10:90954466-90954488 GTTCAAATGGGGTTTTTGTGTGG + Intergenic
1072024683 10:91443252-91443274 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1072025014 10:91446343-91446365 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1072710075 10:97710511-97710533 CATTTTATAGGGTTGTTGTAAGG + Intergenic
1072876289 10:99176093-99176115 CTTCTGATGGGGTTTTTGTGTGG - Intronic
1073171770 10:101516261-101516283 TATTTCATTGGGTTTTTGTAAGG - Intronic
1073716716 10:106115568-106115590 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
1074441175 10:113478717-113478739 ACTTTTATGGAGTTGTTGTAAGG - Intergenic
1074795397 10:116938333-116938355 CTTTGGATGGGGTTTTTGCATGG + Intronic
1075206085 10:120450075-120450097 GTTTTTATGGTTTTCTTCTAGGG - Intergenic
1075481543 10:122786723-122786745 GAATTTCTGGGGTTTCTGTAGGG - Intergenic
1075880212 10:125844669-125844691 GTTTATATGGGGGTTCTTTAGGG + Intronic
1075983801 10:126766210-126766232 CTTTGAATGGGGTTTTTGTGTGG + Intergenic
1076103530 10:127801899-127801921 TTGTTTATAGGGTATTTGTAGGG - Intergenic
1077148802 11:1058982-1059004 GTTTTTTTGTGGTTTTTTTCTGG - Intergenic
1077428193 11:2497835-2497857 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1077762372 11:5116236-5116258 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1078392785 11:10951425-10951447 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1078655417 11:13234473-13234495 TGTTTCATGGGGTTGTTGTAAGG - Intergenic
1078686080 11:13533828-13533850 CCTTTGATGGGGTTTTTGCATGG + Intergenic
1078941464 11:16011164-16011186 CTTTTTATGGACTTTTCGTATGG - Intronic
1079267501 11:18948187-18948209 TTTCTTCTGGGGTTTTTTTATGG - Intergenic
1079481934 11:20890335-20890357 CTTTGGATGGGGTTTTTGTGGGG - Intronic
1079730280 11:23932182-23932204 GTTCTTATGATGTTTTTGCATGG + Intergenic
1079935148 11:26608101-26608123 CCTTGGATGGGGTTTTTGTAGGG + Intronic
1080977254 11:37357536-37357558 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1080992820 11:37560279-37560301 TGTTTTATGAGCTTTTTGTAAGG + Intergenic
1081028712 11:38049873-38049895 GTTTTTAGGAAGTTTATGTAAGG + Intergenic
1082182688 11:49139652-49139674 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1082290931 11:50369147-50369169 GTTTTTCTAGGATATTTGTAGGG + Intergenic
1082872027 11:57952703-57952725 TTTTGGATGGGGTTTTTGTGTGG + Intergenic
1082876215 11:57991858-57991880 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1083062712 11:59891443-59891465 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1083290009 11:61684604-61684626 GTTTTCATGGGGTGTTTGGCAGG + Intronic
1083507129 11:63168140-63168162 CTTTGGATGGGGTTTTTGTGGGG - Intronic
1084450622 11:69234661-69234683 GTTTTTTTGGGGGTTTTTTTTGG - Intergenic
1084818445 11:71665907-71665929 GTTTTTTTGGGTTTTTTTTTTGG + Intergenic
1085335061 11:75687300-75687322 CTTTGGATGGGTTTTTTGTAGGG + Intergenic
1085744461 11:79102855-79102877 GTTCTTATGGATTTTTTTTAAGG + Intronic
1085785804 11:79447693-79447715 GATTTTCTAGGGTTGTTGTAAGG - Intergenic
1086129315 11:83383940-83383962 CTTTGGATGGGGTTTTTGCATGG - Intergenic
1086157532 11:83684056-83684078 GTTTTTATGGGTTTTGTGGTAGG - Intronic
1086279856 11:85172439-85172461 CTTTGAATGGGGTTTTTGTGGGG - Intronic
1086800582 11:91169924-91169946 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1086829764 11:91546031-91546053 CTTTGTATTGAGTTTTTGTATGG - Intergenic
1086959573 11:92968945-92968967 GTTATGATGTGGTTTTTGGAGGG - Intergenic
1087695196 11:101368972-101368994 CTTCTGATGGGGTTTTTGTGTGG + Intergenic
1088008428 11:104969901-104969923 CTTTGGATGGGATTTTTGTAGGG - Intergenic
1088017933 11:105082457-105082479 CTTTGGATGGGATTTTTGTAGGG - Intronic
1088020502 11:105112436-105112458 CTTTGGATGGGATTTTTGTAGGG - Intergenic
1088119749 11:106353948-106353970 GTTTTTTTGTGATTTTTGCAGGG - Intergenic
1088294359 11:108276529-108276551 TTTTGTATGGGGTTTCTGTGTGG + Intronic
1088386589 11:109264683-109264705 GTTAAAATGGTGTTTTTGTAGGG + Intergenic
1090106245 11:123855612-123855634 CTTTGAATGGGGTTTTTGTAAGG - Intergenic
1090307899 11:125705938-125705960 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1091008408 11:131975557-131975579 GCTTTTATTGGGGTTTTGTTTGG - Intronic
1091102038 11:132883748-132883770 TATTTTATAGGGTTTTTATAAGG - Intronic
1091213421 11:133884430-133884452 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1092996065 12:13952052-13952074 ATTTTTATTGGGTTTTTTTTTGG + Intronic
1093233091 12:16573183-16573205 GTTAATATGAGGTTTTTGTCCGG - Intronic
1094060967 12:26315476-26315498 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1094139933 12:27171040-27171062 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1095406399 12:41871127-41871149 CTTTGGATGGGGTTTTTGCACGG - Intergenic
1095538033 12:43275415-43275437 GTTTTTGTCAGGTTTTTGTCAGG - Intergenic
1095595415 12:43952112-43952134 CTTTGGATGGGGTTTTTGTGGGG - Intronic
1095674340 12:44898579-44898601 CTTTGGATGGGGTTTTTGCACGG - Intronic
1095920519 12:47525742-47525764 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1096421212 12:51459493-51459515 CTCCTTCTGGGGTTTTTGTAAGG + Intronic
1096807865 12:54151318-54151340 GTTGCTCTGGGGTTTTTATAGGG + Intergenic
1097306652 12:58076245-58076267 GTTTTTGTGGGGTTTTTTTTTGG + Intergenic
1097508307 12:60504587-60504609 TTTTTTAAGGGGGATTTGTATGG - Intergenic
1098635729 12:72781173-72781195 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1098863902 12:75740450-75740472 GTATGTTTGGGGTTTTTCTATGG + Intergenic
1099104260 12:78480172-78480194 TTTTGTATTGGGATTTTGTAAGG - Intergenic
1099253614 12:80289067-80289089 CTTTGGATGGGGATTTTGTATGG + Intronic
1099487465 12:83246293-83246315 GTTTTTATAGGCTTGTAGTATGG + Intergenic
1099744868 12:86689479-86689501 CTTTGGATGGGGTTTTTGCATGG + Intronic
1100136390 12:91557757-91557779 CTTAGTATGGGGTTTTTGTGTGG - Intergenic
1101296246 12:103425935-103425957 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1101305475 12:103523781-103523803 TCTTTTATGGGGTTGTTGAAAGG - Intergenic
1101334982 12:103789012-103789034 GTTTTTTTTAGGTTTTTGCAGGG - Intronic
1101595914 12:106164163-106164185 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1101821478 12:108187592-108187614 TTTCTTATAGGGTTGTTGTAAGG + Intronic
1102010913 12:109617841-109617863 GTTTTAATGGGGTGTTGGGAGGG + Intergenic
1102516988 12:113456250-113456272 GTTTTTGTGCTGTTTTTATAGGG + Intergenic
1103178928 12:118890729-118890751 TATTTTATAGGGTTCTTGTAAGG - Intergenic
1103259684 12:119575788-119575810 GTTTTGTTTTGGTTTTTGTAAGG + Intergenic
1103430864 12:120884785-120884807 GTTTTTTTGGGTTTTTTTTTTGG + Intronic
1104195155 12:126529870-126529892 GTTTTTTTGTGGTTTTTTTTTGG + Intergenic
1104587536 12:130059525-130059547 GTTTTTATGGGGTATTGGCACGG - Intergenic
1105211030 13:18257102-18257124 GTTTTTGTTGTGTTTTTGTTTGG - Intergenic
1105962020 13:25350699-25350721 GTTCTTATGGGTTTTTTTTGGGG - Intergenic
1106023592 13:25937207-25937229 GTTTTACTTGCGTTTTTGTATGG - Intronic
1106142109 13:27020149-27020171 TTTTTTATGGAGTTTTGCTATGG - Intergenic
1106377329 13:29202674-29202696 TTTCTGATGGGGTTTTTGTGTGG + Intronic
1107248743 13:38331056-38331078 AGTTTTATGGGGTTTTTTTTTGG - Intergenic
1107296974 13:38919669-38919691 GTTTTCATGGGGGCTTTTTAAGG + Intergenic
1107314699 13:39119145-39119167 ATTTGTATGGGGGTTTTGTGGGG + Intergenic
1107719515 13:43233175-43233197 GTTTTTATGGGGGCATTGCAGGG - Intronic
1108173869 13:47772662-47772684 CTTTAAATGGGGTTTTTGTGGGG + Intergenic
1108383914 13:49880352-49880374 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1108678619 13:52760328-52760350 CATTTTATGGGGTTTTAGGAAGG + Intergenic
1109072393 13:57786745-57786767 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1109097128 13:58133273-58133295 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1109102541 13:58203574-58203596 GTTTTTATGGGCTTAGAGTAGGG + Intergenic
1109290996 13:60474511-60474533 GTTTTTAAGTGGTTGCTGTAAGG + Intronic
1109747991 13:66651690-66651712 GTTTTTAATGTGTTTTTGTCAGG - Intronic
1110151209 13:72256247-72256269 GTGTTTATGGGGTGAATGTATGG + Intergenic
1110539877 13:76696197-76696219 CTTTTTCTGATGTTTTTGTATGG - Intergenic
1110824786 13:79959062-79959084 CTTTAGATGGGGTTTTTGCATGG - Intergenic
1111311026 13:86486359-86486381 GATTTTATGAGTTTTTTTTAAGG - Intergenic
1111348487 13:86994906-86994928 CTTTCAATGGGGTTTTTGTGGGG - Intergenic
1111858558 13:93671602-93671624 GTTTTTTAGGGGTTTTTTTTGGG + Intronic
1111879824 13:93942486-93942508 ATTTTTTTGTGTTTTTTGTAGGG + Intronic
1112152034 13:96774152-96774174 CTTTGAATGGGGTTTTTGTGTGG - Intronic
1112254075 13:97812748-97812770 GTTTTTATTGTGTTTTTGCCAGG - Intergenic
1113722428 13:112569725-112569747 AATTTTATGGTGTTTTTGAAGGG - Intronic
1114505095 14:23204794-23204816 ATTTTGATGGGGATTGTGTATGG + Intronic
1114576401 14:23718297-23718319 GTTTTCTTGGGGTTTTTGTTTGG - Intergenic
1115339197 14:32273670-32273692 CTTTAGATGGGGTTTTTGTGTGG - Intergenic
1115633611 14:35269170-35269192 ACTTTTATGGGGTTGTTTTAAGG + Intronic
1115856156 14:37632283-37632305 CTTTGCATGGGGTTTTTGTGTGG + Intronic
1115867117 14:37760167-37760189 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1116002403 14:39258753-39258775 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1116089138 14:40281655-40281677 GGTTTTCTGTTGTTTTTGTAAGG + Intergenic
1116099953 14:40421117-40421139 GTTTTCATGGGTATTTTGTTTGG + Intergenic
1116262285 14:42645898-42645920 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1117172505 14:53114697-53114719 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1117238076 14:53799145-53799167 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1117751156 14:58924725-58924747 TTTTGTATGGGGTTTTTGTGGGG - Intergenic
1117930433 14:60836404-60836426 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1118289571 14:64506774-64506796 ACTTTTTTGGGGTTTTTGTGGGG + Intronic
1118738053 14:68716557-68716579 GTTTTTGTGGGTTTTTTTTTGGG - Intronic
1118930942 14:70239887-70239909 GTTTGTTTGGGGTTTTTTTGAGG + Intergenic
1120271680 14:82321252-82321274 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1120799281 14:88670388-88670410 CTTTGGATGGGGTTTTTGCAGGG - Intronic
1122087150 14:99315845-99315867 GTATTTCTGGGTTTTTTTTATGG - Intergenic
1122201563 14:100125883-100125905 TATTTCATGGGGTTCTTGTAGGG - Intronic
1123815400 15:23973203-23973225 GTATTTCTGTGTTTTTTGTATGG + Intergenic
1124197046 15:27640125-27640147 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1124446828 15:29742087-29742109 GGTTTTCTGGGGTTTTTTTGTGG - Intronic
1125216552 15:37282450-37282472 CATTGAATGGGGTTTTTGTAGGG + Intergenic
1125227274 15:37409119-37409141 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1126306042 15:47258984-47259006 ATTTTTGTAGAGTTTTTGTAGGG + Intronic
1127099952 15:55554009-55554031 CTTTGGATGGGGTTTTTGTGGGG - Intronic
1127925532 15:63537003-63537025 ATTTTCATTTGGTTTTTGTAAGG + Exonic
1128857396 15:71031170-71031192 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1129544851 15:76385028-76385050 GATTTTAAGGTGTTTTTGTTAGG + Intronic
1129566908 15:76633089-76633111 CTTTAAATGGGGTTTTTGTGGGG + Intronic
1129624947 15:77187417-77187439 ATTTTTGTGGGGTTTTTTTTTGG - Intronic
1130626458 15:85520602-85520624 GATTTTATGGGATTAATGTAGGG + Intronic
1131113454 15:89779365-89779387 GTTTTTTTAAGTTTTTTGTAGGG - Intergenic
1131300302 15:91193915-91193937 GTTTTTATCCTCTTTTTGTAGGG + Intronic
1131360964 15:91790022-91790044 AATTTCATGGGGATTTTGTAAGG + Intergenic
1131685450 15:94762630-94762652 TTTTTCATGGAGTTCTTGTAAGG - Intergenic
1131825464 15:96319507-96319529 GTTTTTATAAGGTTTTTTTTGGG - Intergenic
1132129344 15:99261359-99261381 GATTTTATGGTGTTTTGTTATGG - Intronic
1132134955 15:99326851-99326873 TTTCTTATGATGTTTTTGTATGG + Intronic
1132422831 15:101688624-101688646 ATTTTAATGGGGTTTTGGAAAGG - Intronic
1133977942 16:10613315-10613337 ATTATTATGGGGCCTTTGTAGGG - Intergenic
1134360926 16:13530421-13530443 TGTTTTATGGGGTTATTGTGTGG + Intergenic
1136405710 16:30045642-30045664 GTGTTTATGTGGTGTGTGTATGG + Intronic
1136621110 16:31428850-31428872 ATTTTTATGAAGTTTATGTAAGG + Intergenic
1136662203 16:31772606-31772628 CTTTGGATGGGGTTTTTGTGGGG - Intronic
1137565482 16:49530164-49530186 GTCATTACGGGGCTTTTGTATGG + Intronic
1139119713 16:64000927-64000949 GTTTTTAAGTGGTTATTATAAGG - Intergenic
1139720679 16:68850501-68850523 CTGTTTAAGGGGTTTTTGTTTGG + Intronic
1140182596 16:72735724-72735746 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1140494712 16:75374954-75374976 AATTTGGTGGGGTTTTTGTAAGG - Intronic
1140559192 16:75958077-75958099 ATTTATATGTGGTTTTTGTTAGG - Intergenic
1141907151 16:87034284-87034306 GTTTTTTTGGGTTTTTTTAAGGG - Intergenic
1142382752 16:89742978-89743000 GTTTCTATGGCGTGGTTGTATGG - Intronic
1142862038 17:2768312-2768334 GTATTTATGTGATTATTGTATGG + Intergenic
1143658636 17:8311771-8311793 GTTTGTGTGTGGTTTGTGTAGGG - Intronic
1144049059 17:11481894-11481916 TTTTTTATGGCATTTTTTTATGG - Intronic
1144111929 17:12043821-12043843 GTTTTTATGGAGGTTTTATTAGG + Intronic
1144371879 17:14598733-14598755 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1144431884 17:15199525-15199547 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1145028145 17:19484793-19484815 CTTTTTATAGGTTTTCTGTATGG + Intergenic
1146607960 17:34278003-34278025 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1146747090 17:35341363-35341385 GTTTTTAGGGTTTTCTTGTAGGG + Intergenic
1147619505 17:41855991-41856013 GTTTTTTTGGAGTTTTTTTTTGG - Intronic
1149021142 17:51966121-51966143 ATTTTTAGGTGTTTTTTGTATGG - Intronic
1149150781 17:53561474-53561496 GTTTTATTGGGTTTTTTTTAAGG - Intergenic
1149231980 17:54545023-54545045 CTTTGGATGGGGTTTCTGTAGGG - Intergenic
1149283491 17:55133899-55133921 ATTTTTGTAAGGTTTTTGTAAGG + Intronic
1149365566 17:55939952-55939974 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1149922017 17:60669016-60669038 GTTTTTTTTGGGTTTTTTTTTGG + Intergenic
1150190371 17:63232422-63232444 CTTTGGATGGGGTTTTTGTGGGG + Intronic
1151583863 17:74996628-74996650 GTTTTTAGGGGGATGTTGTGGGG - Intronic
1152481179 17:80554192-80554214 TTTTTTTTGGATTTTTTGTAGGG + Intronic
1152954804 18:29061-29083 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
1153855740 18:9144359-9144381 ATTCTTCTGGGGTTTTTGAAGGG - Intronic
1154101437 18:11478614-11478636 CTTTGAATGGGGTTTTTGCATGG + Intergenic
1155117393 18:22783413-22783435 CTTTGGATGGGGTTTTTGGAGGG + Intergenic
1155768645 18:29670754-29670776 GTTTTTTTGGGGGATTTGTGAGG - Intergenic
1156694926 18:39754334-39754356 TTTTGAATGGGGTTTTTGTGGGG - Intergenic
1157016413 18:43720056-43720078 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1157049137 18:44140383-44140405 TAATTTATGGGGTTTTTATAAGG - Intergenic
1157068196 18:44375804-44375826 CTTTGTATGGGGTTTCTGTGTGG - Intergenic
1157178757 18:45477148-45477170 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1158100258 18:53821846-53821868 GTATAGATGGGGTTTTTGTATGG - Intergenic
1158765526 18:60446493-60446515 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159451658 18:68610493-68610515 GTTTTTATGGGAGATTTGTGTGG - Intergenic
1159529051 18:69632127-69632149 GTTTTTATACTGTTTTTGCATGG - Intronic
1159974201 18:74690440-74690462 GTTTTTTTGGGGGTTTTTTTTGG + Intronic
1159988122 18:74869622-74869644 GTATAGATGGGGTTTTTTTAGGG + Intronic
1160178526 18:76615066-76615088 GTTTTTAGGGTGTTTTTTTTTGG - Intergenic
1162399176 19:10434389-10434411 GTTTAGATGGGGTTTCTCTATGG + Intronic
1163455291 19:17403011-17403033 GTTGTTATGGGTTTTTTTTGCGG - Exonic
1163989983 19:20989160-20989182 GTTTGGATGGGGTTTTTGTGTGG - Intergenic
1164059026 19:21649498-21649520 GTTTGGATGGGGTTTTTGTGGGG + Intergenic
1164067636 19:21734037-21734059 CTTTGGATGGGGTTTTTGTGGGG - Intronic
1164543377 19:29139319-29139341 GTTTTTATGGGTTCTTTGCTGGG - Intergenic
1202695559 1_KI270712v1_random:122004-122026 GTCTTTATGAGGTCTTTGAAAGG - Intergenic
924967732 2:93264-93286 CTTTAGATGGGGTTTCTGTATGG - Intergenic
924986005 2:270668-270690 GTTTTATTGGGGTTTTCGGAGGG - Intronic
925191365 2:1886660-1886682 GTTTTTATGTTGTGTTTGTTTGG - Intronic
925207720 2:2021379-2021401 GCTTTTAAAGGGTTTATGTAGGG + Intronic
925252351 2:2450858-2450880 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
925729001 2:6903986-6904008 CTTTGGATGGGGTTTTTGCATGG + Intergenic
925940091 2:8808898-8808920 TTTTTTAGGGGGGTTTGGTAAGG - Intronic
926534277 2:14091540-14091562 TTTCTTATGGTGTCTTTGTATGG + Intergenic
926615165 2:14990244-14990266 TTTTTTTTGGAGTTTTAGTAGGG - Intergenic
927390581 2:22590265-22590287 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
927597461 2:24409076-24409098 GTTTTTTAGGGGTTTTTTTTTGG - Intergenic
928010110 2:27599552-27599574 GTTTTTGTTTTGTTTTTGTATGG + Intronic
928325125 2:30313452-30313474 GTTTTCATGGCATTTTTGTAAGG - Intronic
928488386 2:31755330-31755352 CTTTGGGTGGGGTTTTTGTATGG - Intergenic
928750764 2:34467483-34467505 CTTTGTATGGGGTTTCTGTGTGG - Intergenic
928880284 2:36089365-36089387 CTTTGGATGGGGTATTTGTAGGG - Intergenic
929003666 2:37373703-37373725 ATTTTTTTGGTATTTTTGTATGG + Intergenic
929257633 2:39830144-39830166 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
930179379 2:48337465-48337487 ATTTTTGTGGGGTTTTTTTTTGG + Intronic
930440002 2:51392483-51392505 CTTTGCATGGGGTTTTTGCATGG - Intergenic
930476838 2:51892290-51892312 CTTTGGATGGGCTTTTTGTATGG - Intergenic
930523061 2:52492261-52492283 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
931011726 2:57923882-57923904 ATTTTTATTTGATTTTTGTATGG + Intronic
931538768 2:63305528-63305550 CTTTGGATGGGGTTTTTGTGTGG - Intronic
931836876 2:66108427-66108449 GTTTTCAGGGGCTTTTTGCAGGG - Intergenic
932082651 2:68729524-68729546 GTGTTTATTGGGCATTTGTAAGG - Intronic
932487961 2:72096808-72096830 CATTTTATGGGGTTTTTCTTGGG + Intergenic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933465248 2:82642672-82642694 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
934276723 2:91579045-91579067 GTCTTTATGAGGTCTTTGAAAGG - Intergenic
935515172 2:104027280-104027302 GTTTTTATGGAGTTATTAAAAGG + Intergenic
935852366 2:107236288-107236310 CTTTGGATGGGGTTTTTGTTGGG - Intergenic
935952544 2:108344528-108344550 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
936053814 2:109245399-109245421 GTTTCTTTGTGGTTTTTGTCTGG + Intronic
936089737 2:109493700-109493722 GTGTTTATGGTGTGTATGTATGG - Intronic
936638862 2:114289902-114289924 GTTTTTTTGGGTTTTTTTTTTGG + Intergenic
936640168 2:114303484-114303506 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
936848978 2:116873374-116873396 CCTTGGATGGGGTTTTTGTAGGG + Intergenic
937679419 2:124627541-124627563 CTTTGGATGGGGTTTTTGTGGGG - Intronic
938221262 2:129569807-129569829 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
938391924 2:130913741-130913763 TTTTTAATGGGGTTGTTTTAAGG + Intronic
938708564 2:133955497-133955519 GTTTTTTTGTGTTTTTTTTATGG - Intergenic
938873174 2:135503792-135503814 GTTTTTGTTGTGTTTTTTTAAGG - Intronic
939033376 2:137102360-137102382 CTTCTGATGGGGTTTTTGTGTGG - Intronic
939180490 2:138796912-138796934 TTTTGGATGGGGTTTTTGCATGG - Intergenic
939294192 2:140237578-140237600 GGTTCTATGGGGTTTTGGTTTGG - Intronic
939417236 2:141915353-141915375 ATTTGTATGGTGTATTTGTATGG - Intronic
940054431 2:149499384-149499406 CTTTGGATGGGGTTTTTGCATGG + Intergenic
940381696 2:153022193-153022215 AATTTTATGGAGTTTTTGTCTGG + Intergenic
940538309 2:154976036-154976058 GTCTTGATGGTGTTATTGTATGG - Intergenic
940565034 2:155350680-155350702 TTTTGGATGGGGTTTTTGTCGGG + Intergenic
941119701 2:161514150-161514172 CTTTGGATGGGGTTTTTGTGTGG - Intronic
941136304 2:161722348-161722370 CTTTGGATGGGGTTTTTGTGGGG + Intronic
941587307 2:167376797-167376819 GGTTTTATGGATTCTTTGTATGG + Intergenic
942638289 2:178032867-178032889 CTTTGGATGGGGTTTTTGTGTGG - Intronic
942641833 2:178068796-178068818 CTTTTTATAGGGTTGTTGTAGGG - Intronic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
942807732 2:179953112-179953134 GTTTTTATGGGTTATGTGTTTGG + Intronic
943001384 2:182332530-182332552 GGGTTTCTGGGGTTTTTGTGTGG + Intronic
943286658 2:186009737-186009759 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
943409903 2:187533538-187533560 GTTTGTGTGGGGTTTCTGTGTGG - Intronic
943695145 2:190919561-190919583 GTTTTTTTGTGCTTTTTCTAAGG + Intronic
943836937 2:192525448-192525470 CTTTGGATGGGGTTTCTGTATGG - Intergenic
944764470 2:202850116-202850138 CTTTGGATGGGGTTTTTGTATGG - Intronic
944824018 2:203462425-203462447 TTTTTTAAAGGGTTTTTATATGG - Intronic
945024232 2:205605392-205605414 GTTTTTATGGGGTTTTTTGTTGG + Intronic
945210773 2:207380355-207380377 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
945543939 2:211125337-211125359 GTTTTTATGGGGTTTTCTTGCGG + Intergenic
945628148 2:212237244-212237266 CTTTGGATGGGGTTTTTGTGCGG + Intronic
946569162 2:221002837-221002859 ATTTTTATGGGGTGATTATAGGG + Intergenic
948168551 2:235882029-235882051 GTTTTTCTGGGGTTTTTTTGTGG + Intronic
1168902898 20:1380087-1380109 GTTTTAGTGGACTTTTTGTAGGG - Intronic
1169176752 20:3522886-3522908 CTTTGGATGGGGTTTCTGTATGG - Intronic
1169421222 20:5462555-5462577 CTTTTGATGGGGTTTTTGTGTGG + Intergenic
1169529510 20:6469382-6469404 GTTTTTATTGGGTGTTTGGTGGG + Intergenic
1169987836 20:11466004-11466026 TTTTTTGTGGTGTTTTTGTCTGG + Intergenic
1170183723 20:13563445-13563467 TTTCTTATGGTGTCTTTGTATGG - Intronic
1170266281 20:14470097-14470119 CTTCTGATGGGGTTTTTGTGTGG + Intronic
1170291034 20:14768500-14768522 GTTTTTATGGGATCTCTTTATGG + Intronic
1170727223 20:18941018-18941040 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1171441505 20:25166913-25166935 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1173149483 20:40553731-40553753 GTTTGGATGGGGTTTTTGTGGGG - Intergenic
1174448076 20:50603577-50603599 GTTTCTATGGTGTGTTTGTCAGG - Intronic
1174847926 20:53961833-53961855 GTATTTATGGGATTTTTCCACGG - Intronic
1174951737 20:55049796-55049818 GTTTTTGTGTGGTTTTGGTATGG - Intergenic
1177815923 21:25976643-25976665 GTTTTCTTGGAGTTTTTGGAAGG - Intronic
1177845168 21:26280574-26280596 GTTTGTTTGGGGTTTTTTTGTGG - Intergenic
1178520013 21:33281579-33281601 GTTTTTTGGGGGTTTTTTTGAGG + Intronic
1178572092 21:33748154-33748176 TTTTCTATGTGGTTGTTGTAGGG - Intronic
1179111523 21:38450192-38450214 TTTTTTTTTGGATTTTTGTATGG - Intronic
1181366757 22:22382359-22382381 TTTATTTTGGGGTTTTTTTAAGG + Intergenic
1182410375 22:30180361-30180383 GATTTTAAGGGGTTGTTGTTTGG + Intergenic
1182991252 22:34770048-34770070 GTCTTTGTGGGGTTGTTGTGAGG - Intergenic
949175940 3:1062952-1062974 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
949580498 3:5383457-5383479 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
950407452 3:12813597-12813619 GTTTTTTTAGGGTTATTGTGAGG - Intronic
950621050 3:14205625-14205647 GTTTTTTGGGGGTTTTTTTGGGG + Intergenic
951832264 3:26943538-26943560 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
951957670 3:28275254-28275276 CTTTAGATGGGGTTTTTGTGAGG + Intronic
951996483 3:28735936-28735958 CTTTGAATGGGGTTTTTGTAGGG + Intergenic
952208435 3:31203951-31203973 GATGTTATGGGATTTTTGTTGGG + Intergenic
952216737 3:31285419-31285441 GAATTTCTGGGGCTTTTGTATGG - Intergenic
952572397 3:34732503-34732525 CTTTGGATGGGGTTTTTATAGGG - Intergenic
952653232 3:35751417-35751439 GCTTTTATGGGGCTTTCTTATGG + Intronic
952694697 3:36250921-36250943 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
952742326 3:36746656-36746678 GTTGTCATGGGGTGTCTGTAGGG - Intergenic
953286757 3:41617594-41617616 CTTTGGATGGGGTTTTTGTGTGG - Intronic
953391593 3:42536851-42536873 GTTATTCTGGAGTTTTTGTTTGG + Exonic
953555126 3:43939609-43939631 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
953864193 3:46569991-46570013 GTGTTTGTGGGGTATTTGTGTGG - Intronic
954522824 3:51244573-51244595 GTTTTTTTGGGGATTCTTTAGGG + Intronic
954910953 3:54108439-54108461 GTTTTTATGTTGTTGTTCTATGG + Intergenic
955119030 3:56037019-56037041 CTTTGGATGGGGTTTTTGTAGGG - Intronic
955140550 3:56264705-56264727 TTTTTTATGGGGTCTTTATAGGG - Intronic
955414180 3:58677766-58677788 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
955439854 3:58943545-58943567 CTTTGGATGGGGTTTTTGTGTGG - Intronic
955453861 3:59099681-59099703 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
955565620 3:60241538-60241560 GTTTTTTTGCTTTTTTTGTAAGG + Intronic
955945248 3:64187621-64187643 GTTTTTATGGGGGTTTTAGAAGG + Intronic
955947440 3:64209006-64209028 GTATTTATGGGATGTATGTATGG - Intronic
955947462 3:64209183-64209205 GTATTTATGGGATGTATGTATGG - Intronic
956220194 3:66894000-66894022 GTTTGGATGGGGTTTTTCTTGGG - Intergenic
956233291 3:67040822-67040844 GTTTTTATAACGTTTTTGTTAGG + Intergenic
956550461 3:70452881-70452903 GTTTTTATCAGGTTTGTGAAGGG + Intergenic
956607299 3:71085695-71085717 GTTTTCATTTGGTTCTTGTATGG + Intronic
956818261 3:72928784-72928806 TTTTTTATGGGGTTTTTTTTTGG - Intronic
956987746 3:74722647-74722669 GCTTTTATGGCTTTTATGTAGGG + Intergenic
957474945 3:80710402-80710424 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
957584229 3:82114043-82114065 CCTTGGATGGGGTTTTTGTAGGG + Intergenic
958076809 3:88690913-88690935 ATTTGAATGGGGTTTTTGTGGGG - Intergenic
958506232 3:94981003-94981025 GTTTTTATGTGATTTTTCTAGGG + Intergenic
958650395 3:96930367-96930389 CTTTGAATGGGGTTTTTGTGGGG + Intronic
959120006 3:102222259-102222281 CTTTTGATGAGGTTTTTGTGTGG + Intronic
960210495 3:114959077-114959099 GTTTTTCTTGGGTTTCTGGAAGG - Intronic
960278278 3:115751846-115751868 CTTTGTATGGGGTTTCTGTGTGG - Intergenic
960314851 3:116163863-116163885 GTTTTTTTTGTGTTTTTTTAAGG - Intronic
960491523 3:118321781-118321803 CTTTGAATGGGGTTTTTGTGTGG + Intergenic
960579943 3:119268158-119268180 CTTTTGGTGGGGTTTTTGTGTGG - Intergenic
962552505 3:136509480-136509502 GGTTGTATGGGGTTTTCCTACGG + Intronic
962640025 3:137376467-137376489 CTTTGTATGGGGTTTTTGCGTGG + Intergenic
963401624 3:144806158-144806180 GTTTGGATGGGGTTTTTGTGTGG + Intergenic
963500296 3:146117245-146117267 TTTTTTATGTGGTATTTTTAAGG - Intronic
963531187 3:146475309-146475331 CCTTGCATGGGGTTTTTGTAGGG + Intronic
964049377 3:152372464-152372486 CTTTGGATGGGGTTTTTGTGTGG + Intronic
964206262 3:154178262-154178284 ATTTTAATGGGTTATTTGTATGG - Intronic
964371259 3:156003253-156003275 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
965001591 3:162961364-162961386 TTTTTTATTGGGTTTCTGTCAGG - Intergenic
965068028 3:163877979-163878001 GTTTTTATGAGGGTTTTGTTGGG + Intergenic
965184398 3:165445126-165445148 GTTTTTACTGGGGTTTTGTTAGG - Intergenic
965264297 3:166521006-166521028 GTTTTTTGAGGGTTTTTATATGG + Intergenic
966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG + Intronic
966629309 3:182054832-182054854 ATATTCATGGTGTTTTTGTAGGG + Intergenic
967172809 3:186836702-186836724 TTTTATGTCGGGTTTTTGTACGG + Intergenic
968358918 3:198133082-198133104 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
968437065 4:599088-599110 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
968696574 4:2033076-2033098 CTTTAGATGGGGTTTTTGTGGGG + Intronic
969034043 4:4237343-4237365 GTCTTTATGAGGTCTTTGAAAGG + Intronic
969207070 4:5655163-5655185 GTTCTTATGGGGTTTGTAAAGGG - Intronic
969854105 4:9985328-9985350 GTTTTCATGGGGCTTTTATGAGG - Intronic
970107008 4:12596035-12596057 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
971084820 4:23261042-23261064 ATTTTTAAGGGATTTTTGTTTGG - Intergenic
971429948 4:26555680-26555702 CATTGGATGGGGTTTTTGTATGG + Intergenic
971516747 4:27496783-27496805 CTTTGGATGGGGTTTGTGTAGGG - Intergenic
971673501 4:29594865-29594887 CTTTGCATGGGGTTTTTGTGTGG + Intergenic
971737989 4:30481913-30481935 GGTTTAAAGGGGTTTTTATATGG + Intergenic
971745641 4:30576151-30576173 CTTTTTTAGGGGTCTTTGTAAGG - Intergenic
971746338 4:30586404-30586426 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
972219427 4:36936591-36936613 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
972372345 4:38437367-38437389 TTTTGGATGGGGTTTTTGTAGGG + Intergenic
972755672 4:42043050-42043072 TTTTGGATGGGGTTTTTGTGTGG - Intronic
972847975 4:43012647-43012669 ATGTTTATAGGGTTGTTGTAAGG - Intronic
973315384 4:48754646-48754668 GATTTTCTGGGGTTTTTTTGGGG + Intronic
973837588 4:54825675-54825697 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
974238871 4:59216962-59216984 CTTCTTATGTGGTTATTGTAAGG + Intergenic
974302172 4:60082259-60082281 TTTTGGATGGGTTTTTTGTATGG - Intergenic
974326200 4:60418533-60418555 CTTTGGATGGGGTTTTTGCATGG + Intergenic
974462917 4:62211347-62211369 CTTTTTTTGCAGTTTTTGTAAGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974560187 4:63506926-63506948 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
974604390 4:64131830-64131852 GGTATTATGTGGTTTTTATATGG - Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975212893 4:71721922-71721944 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
975227623 4:71892373-71892395 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
975366867 4:73539719-73539741 GTTTTTGTTTGGTTTTTGTTTGG - Intergenic
975489952 4:74976931-74976953 CTTTGGATAGGGTTTTTGTAGGG - Intronic
975833956 4:78401002-78401024 GTTTTTAAAGGGGATTTGTAAGG - Intronic
976445870 4:85129289-85129311 CTTCTGATGGGGTTTTTGTGTGG + Intergenic
976655816 4:87488263-87488285 CTTTGGATGGGGTTTTTGTGTGG + Intronic
976830127 4:89306502-89306524 GTTTTTATTTTGTTTTTGCAAGG - Intronic
977111423 4:92961030-92961052 ATTTTTAGGGAGTTATTGTAAGG - Intronic
977434007 4:96970235-96970257 GTATTTATGTGGTTTTTAAATGG + Intergenic
977473906 4:97479007-97479029 GTTTGTATGCTGTTGTTGTAGGG - Intronic
977636972 4:99310465-99310487 TTTTTTGTGGGGTTTTTTTTGGG + Intronic
977897714 4:102383474-102383496 TTTTGGATGGGGTTTTTGTGTGG + Intronic
978185953 4:105857586-105857608 CTTTGGATGGGGTTTTTGTGTGG + Intronic
978383985 4:108161945-108161967 GTTTTTTTGCTGTTTTTGGAGGG - Intronic
978669021 4:111223881-111223903 GTTTTTGTGGAGTTTTTTTGGGG + Intergenic
978718461 4:111875241-111875263 GTTTGTTTGGGGGTTTTGAATGG + Intergenic
978973318 4:114837285-114837307 CTTTGGATGGGGTTTTTGTGTGG + Intronic
979668165 4:123335841-123335863 CTTTGGATGGGGTTTTTGCATGG + Intergenic
979732713 4:124044698-124044720 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
979782874 4:124677604-124677626 TTTCTTATAGGATTTTTGTAAGG - Intronic
979819266 4:125151022-125151044 CTTTGAATGGGGTTTTTGTGTGG + Intergenic
980171184 4:129292107-129292129 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
980275996 4:130651348-130651370 CTTTAGATGGGGTTTTTGTGTGG - Intergenic
980400371 4:132276619-132276641 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
980494071 4:133569487-133569509 CTTTGAATGGGGTTTTTGTGTGG + Intergenic
980511612 4:133797618-133797640 CTTTATATGAGGTTTCTGTATGG + Intergenic
980645232 4:135635436-135635458 TTTCTAATGGGGTTTTTGTGGGG + Intergenic
981131680 4:141163778-141163800 CTTTGGATGGGGTTTTTGTGTGG - Intronic
981273942 4:142875579-142875601 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
981671657 4:147293436-147293458 CTTTGAATGGGGTTTTTGTGTGG - Intergenic
981813300 4:148800315-148800337 CTTTTGATGGAGTTTTTTTAGGG - Intergenic
981864647 4:149401811-149401833 GTTTTCATGGAGTATTTGTTGGG - Intergenic
982701929 4:158666297-158666319 ATTCCTTTGGGGTTTTTGTAGGG + Intergenic
982810815 4:159824030-159824052 GTTTTTATGGAGATCTTGAAGGG - Intergenic
982852846 4:160341645-160341667 CTTTAGATGGGGTTTTTGTGCGG + Intergenic
983169491 4:164520206-164520228 TTTTGGATGGGGTTTTTGTGGGG + Intergenic
983251178 4:165348115-165348137 GCTTTTCTGGTGTGTTTGTATGG - Intergenic
983315963 4:166133672-166133694 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
983957700 4:173716544-173716566 CTTTGAATGGGGTTTTTGTGAGG - Intergenic
984269750 4:177536478-177536500 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
985029932 4:185779315-185779337 TTTTTTATTGGGTTGTTGTGAGG + Intronic
985701129 5:1373474-1373496 GTTGTAATGGGGTTTGTGAAGGG + Intergenic
985829480 5:2217532-2217554 CTTTCTATGGGGTCTTTGTGCGG + Intergenic
985883977 5:2661992-2662014 GTTTTTATTGTGCTTTTGTAAGG - Intergenic
986011785 5:3723888-3723910 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
986492531 5:8307297-8307319 CCTTGGATGGGGTTTTTGTAGGG - Intergenic
986753654 5:10812994-10813016 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
986773368 5:10993314-10993336 ATATTTATGCGGTTTTTATAAGG - Intronic
987010215 5:13755347-13755369 ATTTTTATAGGATTTTTTTATGG - Intronic
987198714 5:15553108-15553130 GTTTTTTGGGGGTTTTTGTTTGG - Intronic
987626645 5:20410164-20410186 CTTTTTGTGGTGTTTTTGTCTGG - Intronic
988320020 5:29683058-29683080 GTTTTTAGTGGGTTTTTTCAAGG + Intergenic
988667014 5:33340159-33340181 GTTTTTACAGGGTTTTTTTTTGG - Intergenic
988719317 5:33859984-33860006 ATTTGGATGGGGTTTTTGTTTGG - Intronic
989083967 5:37656108-37656130 CTTTGGATGGGGTTTTTGTGTGG + Intronic
989241534 5:39208306-39208328 TTTTTTATGGGCTTTATATAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990704843 5:58516125-58516147 TTTTGAATGGGGTTTTTGTGAGG - Intergenic
991242439 5:64475029-64475051 CTTTTGATGGGGTTTTTGTGTGG - Intergenic
991676891 5:69096971-69096993 GTTTTTTTGGGGTTTTTTTTTGG - Intronic
991983854 5:72262389-72262411 GTTTTTATGGGTTTTTTTCTGGG - Intronic
992037988 5:72800245-72800267 CTTTTTATGTTGTCTTTGTATGG + Intergenic
992383234 5:76259077-76259099 TTTTTTGTGGGGTTTTTACAGGG + Intronic
992905680 5:81343196-81343218 GTTTTTGTTGGGTTTTTTTTTGG - Intronic
993255623 5:85587393-85587415 CTTTGGATGGGGTTTTTGCATGG + Intergenic
993349639 5:86833034-86833056 CTTTTTATGAGGTTTTAGAAAGG + Intergenic
993455400 5:88121208-88121230 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
994150203 5:96439244-96439266 GTTTTTGAGGGGTTTTAGTGGGG - Intergenic
994349822 5:98732019-98732041 ATTTATATGTGATTTTTGTAAGG - Intergenic
994519133 5:100808077-100808099 GTTTTCATGTGGTTATTGTAGGG - Exonic
994641365 5:102413577-102413599 GTCTTTATTTGGTCTTTGTATGG + Intronic
994642066 5:102422095-102422117 CTTTGGATGGGGTTTTTGCATGG - Intronic
995464519 5:112436903-112436925 CTTTGGATGGGGTTTTTGTATGG - Intergenic
995806200 5:116054925-116054947 GTTTTTATGGAGTTTTTAATGGG - Intronic
995813744 5:116141795-116141817 TTTTGTATGGTGATTTTGTAAGG + Intronic
995826886 5:116310015-116310037 GTTTTTAGGGTTTTTTTGTTTGG + Intronic
996034360 5:118741462-118741484 GTTTCTTTGGGGTTTTTTTGGGG + Intergenic
996190642 5:120537211-120537233 GTTCTTCTGGGATTTTTATATGG - Intronic
996215752 5:120862978-120863000 GTTTTGATCAGGTTTTTATAGGG + Intergenic
996463116 5:123770222-123770244 CTTTCAATGGGGTTTTTGTGGGG + Intergenic
996829809 5:127727542-127727564 TTTTGGATGGGGTTTTTGTGGGG - Intergenic
997892928 5:137691072-137691094 ATTTTAATGGGGTTTTGGGAGGG - Intronic
998689116 5:144567340-144567362 GTTCTTTTGGTCTTTTTGTATGG + Intergenic
998751983 5:145332935-145332957 CTTCAGATGGGGTTTTTGTATGG + Intergenic
999872136 5:155763800-155763822 GTTTTTATAGGGTTTTGGTGGGG - Intergenic
1000043000 5:157499157-157499179 TATTTTATGGGGTTTTTGTGAGG + Intronic
1001372506 5:171220062-171220084 CTTTAAATGGAGTTTTTGTATGG + Intronic
1002208473 5:177580746-177580768 CTTTGTATGGGGTCTTTGTATGG + Intergenic
1002676494 5:180918161-180918183 TTTTTTATGGTGTTCTTATATGG - Intronic
1002806899 6:585998-586020 GTTTTTATGCGGGTTTTCTCAGG - Intronic
1003208382 6:4036211-4036233 GTTTTTGTGGGGTTTTTCTGGGG + Intronic
1003248860 6:4406617-4406639 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1003350029 6:5307998-5308020 ATTTATATGGGGATTTTTTAAGG + Intronic
1003625479 6:7737459-7737481 ATTTTTATGGGGTCTGTTTAGGG + Intronic
1003902460 6:10667898-10667920 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
1005274299 6:24199485-24199507 CTTCTGATGGGGTTTTTGTGTGG - Intronic
1005728226 6:28670656-28670678 GTTTTTTGGGGTTTTTTGGATGG + Intergenic
1005846589 6:29784986-29785008 CTTTTTATGGGGTTGTTTGATGG - Intergenic
1006119898 6:31797621-31797643 GGTTTTGTGGGTTTTTTTTAAGG - Exonic
1008109924 6:47480851-47480873 GTATCTATGTGGTTTCTGTAAGG - Intronic
1008312035 6:49988866-49988888 GTTTTAATGGTGTTTTTTTCTGG - Intergenic
1008758286 6:54824144-54824166 CTTTCGATGGGGTTTTTGTGTGG + Intergenic
1009320548 6:62283287-62283309 GTTTATTTGGGGTTTTTGGGGGG - Intronic
1009707028 6:67265739-67265761 CTTTAGATGGGGTTTTTGTTTGG + Intergenic
1010094709 6:72027757-72027779 ATTTTTATGGGTTTTTTTAATGG + Intronic
1011104583 6:83765610-83765632 GTTTTTGTGGGGATTTTGTTGGG - Intergenic
1011214251 6:84987940-84987962 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
1011725303 6:90204938-90204960 GTTTTTGAGGAGTTTTTGTTTGG - Intronic
1011916153 6:92509111-92509133 TTTTGAATGGGGTTTTTGTGAGG - Intergenic
1012127824 6:95453445-95453467 CTTTGGATGGGGTTTTTGCACGG + Intergenic
1012434725 6:99203531-99203553 ACTTGAATGGGGTTTTTGTAGGG + Intergenic
1013038101 6:106405849-106405871 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1013678683 6:112497252-112497274 GCTTTTATGCTGTTTTTATAGGG - Intergenic
1013682703 6:112542321-112542343 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1014344287 6:120248209-120248231 GGTTTTATGGTGGCTTTGTATGG + Intergenic
1014589338 6:123244067-123244089 CTTTGGATGGGGTTTTTGCATGG - Intronic
1014836444 6:126166304-126166326 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1014868331 6:126559420-126559442 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1014872519 6:126614222-126614244 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1015136900 6:129882637-129882659 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1015433112 6:133154232-133154254 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1015587476 6:134790203-134790225 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1016043937 6:139462023-139462045 GTTTTAATGGGCCTTTTGTTGGG + Intergenic
1016073468 6:139768933-139768955 TGTTTTATGGGGTTTCTGTGGGG + Intergenic
1016246060 6:141982395-141982417 GTGTTTATGGGGTTTGTTTTAGG + Intergenic
1016867820 6:148785937-148785959 GTTTTTATGGGTATTTTGAGGGG + Intronic
1017758218 6:157547877-157547899 CTTTTTGTTGGGTTTTTTTAAGG + Intronic
1018780652 6:167061569-167061591 TTTCTTATGAGGTTTTTGTCTGG - Intergenic
1019380771 7:721997-722019 CTTAGTATGGGGTTTTTGGAGGG + Intronic
1020557830 7:9691926-9691948 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1020629842 7:10626345-10626367 CTTTGGATGGGGTTTTTGTCGGG - Intergenic
1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG + Intergenic
1020960030 7:14790618-14790640 ATTTTTATGGGTTTATTTTAGGG + Intronic
1021347571 7:19547417-19547439 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1021408042 7:20297007-20297029 GTTTTTAAAAAGTTTTTGTATGG + Intergenic
1021482547 7:21133448-21133470 GTTTTTCTGGGGTTTATGATTGG - Intergenic
1021776615 7:24060393-24060415 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1022094065 7:27127614-27127636 GTTTTTGTGGTCTTATTGTAGGG + Intronic
1022344135 7:29497464-29497486 GTTTTTGTGGGGTTTTTTTCTGG + Intronic
1023713640 7:43021254-43021276 TTTTTTATGGGATTTTAGCAGGG - Intergenic
1023894414 7:44419819-44419841 CTTTGTATAGGGTTTTTGTGTGG - Intronic
1024034277 7:45494622-45494644 ATTTTTGGGGGGTTTTTGTGGGG + Intergenic
1024153069 7:46591919-46591941 CTTTGTATGGGGTTTTTGAGTGG - Intergenic
1024255280 7:47536240-47536262 GTTTTTCTGAAGCTTTTGTAAGG - Intronic
1024838461 7:53554181-53554203 CTTGCTAGGGGGTTTTTGTATGG + Intergenic
1025092130 7:56072987-56073009 GTCTTTATAGGGATTTTGTCAGG + Exonic
1025710355 7:63902102-63902124 GTTTTTAGGGTTTTTTTTTATGG - Intergenic
1026299202 7:69082559-69082581 TTTGTTTTGGGGTTTTTGTTTGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1028327124 7:89540936-89540958 GTTTGGATGGGGTTTTTGCATGG - Intergenic
1028489558 7:91395686-91395708 TTTTTTAATGGGCTTTTGTAAGG + Intergenic
1028500530 7:91514469-91514491 GTTTTTATGATGATTTTGTTTGG - Intergenic
1028583654 7:92432355-92432377 GTATTTGTAGGGTTGTTGTAAGG + Intergenic
1029550810 7:101236241-101236263 GCTTTTATAGGGTTTTTTTTGGG + Intronic
1029589937 7:101500650-101500672 ATTTTTGTGGGGTTTTTTTTAGG - Intronic
1029808116 7:103017304-103017326 GTACAGATGGGGTTTTTGTATGG - Intronic
1030170015 7:106591481-106591503 GCTTTTTCCGGGTTTTTGTAGGG - Intergenic
1031613658 7:123856361-123856383 CTTTGGATGGGGTTTTTGCATGG + Intronic
1031716632 7:125116537-125116559 GTTGTTATGGGGTTTTAATATGG + Intergenic
1031867739 7:127057444-127057466 GTTTTTATAGGGATATTGTATGG - Intronic
1031946151 7:127842872-127842894 GATTATATGGAGTTTTTCTATGG + Intronic
1031968544 7:128046332-128046354 GTTTTTTTGGGTTTTTTTTTTGG + Intronic
1032107814 7:129049625-129049647 ATTTTTATTGGATTTTTGGAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034142487 7:148834782-148834804 GTTTTTATTGGATTATTGGATGG - Intronic
1034365598 7:150543609-150543631 CTTTGGATGGGGTTTTTGCATGG - Intergenic
1034614018 7:152398993-152399015 ATTTTTGTGGGATTTTTTTAGGG + Intronic
1038706827 8:29902024-29902046 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1038936328 8:32256355-32256377 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1039025282 8:33252189-33252211 TTTTGGATGGGGTTTTTGTGGGG + Intergenic
1039043436 8:33429099-33429121 TTTTCTTTAGGGTTTTTGTAAGG - Intronic
1039293742 8:36127110-36127132 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1039380193 8:37077725-37077747 GGTTCTAAGGGATTTTTGTATGG - Intergenic
1039637009 8:39178681-39178703 CTTTGAATGGGGTTTTTGTGGGG + Intronic
1039950325 8:42166458-42166480 TACCTTATGGGGTTTTTGTAAGG + Intronic
1041341151 8:56847223-56847245 CTTTGGATGGGGTTTTTGTGGGG - Intergenic
1041459628 8:58097713-58097735 CTTTGGATGGGGTTTTGGTATGG + Intronic
1041760420 8:61360262-61360284 GTTTTTTTTGGGTTTTTTAAAGG - Intronic
1042812799 8:72845107-72845129 CTTTGGATGGGGTTTTTGTGTGG + Intronic
1042969208 8:74390350-74390372 CTTCGTATGGGGTTTTTGTGTGG + Intronic
1043036566 8:75207493-75207515 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1043253551 8:78105761-78105783 TTTTGGATGGGGTTTTTGTGTGG + Intergenic
1044193289 8:89344566-89344588 GTTGTTTTGGGGTTTTTCTTTGG + Intergenic
1044378025 8:91499524-91499546 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1044405371 8:91819707-91819729 CTTTGGATGGGCTTTTTGTATGG - Intergenic
1044505099 8:93007354-93007376 TTTTGGATGGGGTTTTTGTGGGG - Intronic
1044508466 8:93048705-93048727 CTTTGTATGGGGTTTTTGTGGGG + Intergenic
1044598003 8:93977267-93977289 GTTTTTTTGTTTTTTTTGTAGGG - Intergenic
1045732872 8:105262761-105262783 CTTTGAATGGGGTTTTTGTGGGG + Intronic
1046014728 8:108591041-108591063 CTTTGGATGGGGTTTTTGTATGG - Intergenic
1046030379 8:108776159-108776181 GATTTTGTTGGGTTTTGGTATGG + Intronic
1046812457 8:118547630-118547652 GTCTTTATGGGTTTCTTGAAAGG + Intronic
1046984558 8:120372855-120372877 GTTTTTTTGGTGTCTTTGCAGGG + Intergenic
1047133785 8:122052330-122052352 GTTTGGATGGGGTTTTTGTGTGG - Intergenic
1047565940 8:126043826-126043848 GGTTTTATTGGTTCTTTGTATGG + Intergenic
1047876459 8:129143294-129143316 GTTGTTTTGAAGTTTTTGTAGGG + Intergenic
1048429205 8:134353414-134353436 CTTTGTATAGGGTTTTTGTGGGG + Intergenic
1049964718 9:767705-767727 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1050310474 9:4347724-4347746 GTTTTTTTGAGGTTTTTTTTTGG + Intronic
1050607622 9:7317779-7317801 GTTTTCATGGGGTTTGAGAAGGG - Intergenic
1050660849 9:7880852-7880874 CCTTGGATGGGGTTTTTGTAGGG - Intronic
1050714508 9:8507123-8507145 GTTGTTTTGGGGTTTTTCTTGGG + Intronic
1051003527 9:12314704-12314726 CCTTGGATGGGGTTTTTGTAGGG + Intergenic
1051703902 9:19856454-19856476 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1052052605 9:23865773-23865795 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1052143920 9:25024734-25024756 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1054527453 9:66147596-66147618 TTTTTTGTGGGGTTTTTTTTTGG + Intronic
1055441858 9:76344363-76344385 GTTTTTATGGAGTTGCTTTAGGG - Intronic
1055628863 9:78201899-78201921 GTTCAGATGGGGTTTTTGTGTGG - Intergenic
1055842821 9:80526474-80526496 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
1055931626 9:81565181-81565203 GTTTTGATTTGGTTTTTGTTTGG + Intergenic
1056116022 9:83442217-83442239 CCCTTTATGTGGTTTTTGTAAGG - Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056735147 9:89203160-89203182 GTTTTTATGGTATTTTGCTATGG - Intergenic
1056740817 9:89253461-89253483 GTGTTTATGTGGTGTGTGTATGG + Intergenic
1057241553 9:93416325-93416347 CTTTTGATGGAGTTTTTGTGGGG + Intergenic
1057284070 9:93734563-93734585 GTTTTTGTCAGGTTTTTGTCAGG - Intergenic
1057987351 9:99730627-99730649 GTGTTTTTGGGGTTTGTGTGTGG - Intergenic
1058675328 9:107395321-107395343 GTTTTACAGGGGTTTTTGGATGG - Intergenic
1058775825 9:108282742-108282764 ATTATTATGGGGTTTCTGTGGGG - Intergenic
1058776813 9:108292637-108292659 GTTTTTAGGAGGTGTTTGTGGGG - Intergenic
1058858276 9:109088282-109088304 GTTCTTTTAGGGCTTTTGTAGGG - Intronic
1059257093 9:112940673-112940695 GTTTTAATGGGGTTTCAGGAGGG + Intergenic
1059509892 9:114835594-114835616 CTTTGAATGGGGTTTTTGTGAGG + Intergenic
1060058381 9:120436159-120436181 GTTCTTATGGTGTTTTCTTAAGG - Intronic
1060340234 9:122768564-122768586 CTTTGAATGGGGTTTTTATAGGG - Intergenic
1062297720 9:135841820-135841842 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1186774740 X:12853951-12853973 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1186832630 X:13405231-13405253 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1186948173 X:14592501-14592523 GTTTTTTTGTATTTTTTGTAGGG - Intronic
1187620496 X:21047685-21047707 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1188155745 X:26740121-26740143 GTTTTAATGGTATTTGTGTACGG + Intergenic
1188860723 X:35252108-35252130 TTTTGGATGGGGTTTTTGTGGGG - Intergenic
1189039656 X:37529624-37529646 CTTTGTATGGGGTTTTTGCATGG + Intronic
1189300063 X:39946010-39946032 GTTTTGGGGGGGTTTTTGCAGGG + Intergenic
1189560757 X:42189189-42189211 GTTTTTATGATGTTTTCCTAAGG + Intergenic
1190083072 X:47372031-47372053 GTTTGTGTAAGGTTTTTGTAGGG + Intronic
1190583667 X:51915161-51915183 TTTTTTATGGTGTCTTTGTCTGG - Intergenic
1190727957 X:53203734-53203756 GTTTTTTGGGGGATTTTTTAGGG + Intronic
1191185449 X:57606911-57606933 CTTTGGATGGGGTTTTTGTGGGG + Intergenic
1191225083 X:58034520-58034542 CTTTAAATGGGGTTTTTGTGGGG + Intergenic
1191788652 X:64945247-64945269 CTTTAAATGGGGTTTTTGTGTGG + Intronic
1191900540 X:66035706-66035728 GTTTTCATGGGGTTTAAGCATGG - Intronic
1191928607 X:66343813-66343835 CTTTAGATGGGGTTTTTGTTTGG + Intergenic
1191966627 X:66766274-66766296 CTTTGCATGGGGTTTTTGTTTGG + Intergenic
1192163321 X:68804980-68805002 GTATTTATGGACTTTTTGTCGGG + Intergenic
1192387354 X:70684981-70685003 GGTTTTTTGGGGTTTTTTTCTGG - Intronic
1192403816 X:70863548-70863570 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1192755722 X:74045767-74045789 CTTCGGATGGGGTTTTTGTATGG + Intergenic
1192788816 X:74359667-74359689 GTTTTTGTGTTTTTTTTGTAGGG - Intergenic
1193040353 X:76998154-76998176 CCTTGGATGGGGTTTTTGTATGG + Intergenic
1193113655 X:77755502-77755524 CTTTTGATGGGGTTTTTGTGTGG + Intronic
1193226893 X:78994186-78994208 GTTTTTTTGTTGTTTTTGTTGGG + Intergenic
1193233080 X:79072169-79072191 CTTTTGATTGGGTTTTTGTGGGG - Intergenic
1193350940 X:80463457-80463479 CTTTGGATGGGGTTTTGGTATGG - Intergenic
1193458145 X:81755791-81755813 CTTTAAATGGGGTTTTTGTGGGG - Intergenic
1193533528 X:82685996-82686018 GTTTGGATGGAGTTTTTGTGGGG + Intergenic
1193539492 X:82753875-82753897 GTTTTTTTTGGTTTTTTTTATGG + Intergenic
1193615900 X:83688077-83688099 GTTCACATGGGGTTTTTGTGTGG + Intergenic
1193636371 X:83954492-83954514 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1193645819 X:84067098-84067120 TTTTATATGGAGTTTTTGTGTGG - Intronic
1193699388 X:84743457-84743479 GCCTTTATGTGGTTTTTGGAGGG - Intergenic
1194263894 X:91732959-91732981 CTTTGAATGGGGTTTTTGTGGGG + Intergenic
1194530969 X:95047765-95047787 GTTTTTATGAGGTTTGTTTTTGG + Intergenic
1194624892 X:96215500-96215522 CTTTGGATGGGGTTTTTGTGTGG - Intergenic
1194783027 X:98048522-98048544 CTTTAGATGGGGTTTTTGTGTGG + Intergenic
1194964110 X:100267801-100267823 GTTTGGATGGGGTTTTTGTGTGG - Intergenic
1194972662 X:100361350-100361372 TTCTTTATGTGGTTTTTCTAAGG - Intronic
1195213007 X:102669009-102669031 CTTTGTATGGGGTTTTTGTGTGG + Intergenic
1195655567 X:107328437-107328459 GTTATTATGGAGTTATTATAAGG + Intergenic
1195678809 X:107528164-107528186 CTTTTTATAGGGCTTTTATAGGG - Intronic
1195728671 X:107943246-107943268 GTTTTTTGGGGGTTTTTTTTTGG - Intergenic
1195730157 X:107959053-107959075 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1195812770 X:108852172-108852194 CTTTGAATGGGGTTTTTGTGGGG - Intergenic
1195820766 X:108943568-108943590 CTTTGGATGGGGTTTTTGGATGG + Intergenic
1196026502 X:111046693-111046715 CTGTTCATGGGGTTTTTGTAAGG + Intronic
1196054576 X:111340859-111340881 CTTTACATGGGGTTTTTGTGGGG - Intronic
1196078501 X:111604764-111604786 TTTTTTCTGATGTTTTTGTAAGG + Intergenic
1196216042 X:113052605-113052627 GTCTTTATCTGGTTTTTGTCAGG - Intergenic
1196476328 X:116091370-116091392 CTTTGGATGGGGTTTTTGTGTGG + Intergenic
1197107458 X:122732706-122732728 CTTTGAATGGGGTTTTTGTTAGG - Intergenic
1197191199 X:123649286-123649308 GTTCAGATGGGGTTTTTGTGTGG - Intronic
1197574659 X:128197026-128197048 GTTGTTATGAGGTTTTTTTGTGG - Intergenic
1197578976 X:128258140-128258162 GGTTTTATGGATCTTTTGTATGG - Intergenic
1197579691 X:128266316-128266338 GTTCTTATGAGGTTGTTATAAGG - Intergenic
1198559005 X:137828047-137828069 GTTTCTATGGTGATTATGTATGG + Intergenic
1198724829 X:139665823-139665845 GTTTTCATGTGTTTTTTATAAGG + Intronic
1198753661 X:139959897-139959919 CTTTGGATGGGGTTTTTGTGTGG - Intronic
1198784368 X:140272051-140272073 CTTTGGATGGGGTTTTTGTTGGG + Intergenic
1199913939 X:152318333-152318355 GTTTTTATGGTTTTTTTGTTTGG - Intronic
1200740171 Y:6845999-6846021 CTTTGGATGGGGTTTTTGCATGG + Intergenic
1200818336 Y:7556027-7556049 CCTTAGATGGGGTTTTTGTAGGG - Intergenic
1201359029 Y:13126643-13126665 CTTTGGATGGGGTTTTTGTCAGG + Intergenic
1202253874 Y:22901165-22901187 GTATAGATGGGGTTTTTGTGTGG + Intergenic
1202406864 Y:24534914-24534936 GTATAGATGGGGTTTTTGTGTGG + Intergenic
1202463917 Y:25135167-25135189 GTATAGATGGGGTTTTTGTGTGG - Intergenic