ID: 966064415

View in Genome Browser
Species Human (GRCh38)
Location 3:175800676-175800698
Sequence CAGTAGACCCTCAATAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966064415 Original CRISPR CAGTAGACCCTCAATAATGT TGG (reversed) Intronic
900288238 1:1912100-1912122 CACATGACCCTCCATAATGTAGG - Intergenic
900768635 1:4522493-4522515 CAGATGACCTTCCATAATGTAGG + Intergenic
901295910 1:8160749-8160771 GAGATTACCCTCAATAATGTGGG - Intergenic
901777939 1:11573490-11573512 CAGATGACCCTCCACAATGTGGG - Intergenic
903370367 1:22831428-22831450 CAGTAGGCACTCAATATTTTTGG - Intronic
903662439 1:24986530-24986552 CAGGTGACCCTCCATAATGTGGG + Intergenic
904618388 1:31761934-31761956 CAGTTGACCCTCTATAAAATGGG - Intronic
905664469 1:39754513-39754535 CAGATTACCCTCCATAATGTGGG - Intronic
907061129 1:51426601-51426623 CAGATTACCCTCAATAATGTAGG + Intronic
907988562 1:59556765-59556787 CAGCAGACACTCAAAAATGGTGG + Intronic
909356516 1:74715965-74715987 CAGATGACCCTCTAGAATGTGGG + Intronic
909448036 1:75769198-75769220 CAGGAGACTTTCAATGATGTTGG - Intronic
909740109 1:79018496-79018518 CAGCAGACACTCAGTAATGTTGG - Intergenic
910203804 1:84726892-84726914 CAGAGCACCCTCCATAATGTGGG - Intergenic
910999514 1:93147738-93147760 CATTAGACACTTAATAATCTTGG + Intergenic
911074831 1:93862974-93862996 CAGGACACCCACAATAATGGTGG + Intergenic
912067692 1:105765337-105765359 AGGTAGAGCTTCAATAATGTAGG - Intergenic
915389489 1:155528650-155528672 CAGATCACCCTCCATAATGTTGG - Intronic
920669523 1:207992464-207992486 CAGATTACCCTCCATAATGTGGG + Intergenic
920942109 1:210493458-210493480 CAGATTACCCTCCATAATGTGGG - Intronic
921514610 1:216074634-216074656 CAGTAGACACTCAATAAGTTGGG + Intronic
923653807 1:235898262-235898284 CAGTGCAGCCTCAAAAATGTGGG - Intergenic
1065905729 10:30249421-30249443 CAGATGACCCTCCATGATGTGGG + Intergenic
1070706621 10:78643716-78643738 CAGACCACCCTCCATAATGTGGG - Intergenic
1071672069 10:87618239-87618261 CAGAGTACCCTCCATAATGTGGG + Intergenic
1080798562 11:35588553-35588575 CAGATTACCCTCCATAATGTGGG + Intergenic
1081000758 11:37667800-37667822 AATTATAGCCTCAATAATGTGGG - Intergenic
1081273417 11:41116547-41116569 TAGTAAATCCTCAATAATATTGG - Intronic
1081415743 11:42813125-42813147 CAGATGACCTTCCATAATGTGGG + Intergenic
1083037624 11:59654848-59654870 GAGATTACCCTCAATAATGTGGG + Intronic
1083533522 11:63447424-63447446 CAGTAGATTCTGTATAATGTTGG + Intergenic
1084200756 11:67556426-67556448 CAGATGACCCTCCATAATGGGGG - Intergenic
1089959543 11:122603799-122603821 CTTTAGAACCTCAAGAATGTAGG - Intergenic
1091287895 11:134418577-134418599 CCCTAAATCCTCAATAATGTAGG + Intergenic
1092546301 12:9454516-9454538 CAGATTACCCTCCATAATGTGGG - Intergenic
1093502995 12:19833755-19833777 CAGTTGGCCCTCCATAATGTAGG + Intergenic
1097532798 12:60826390-60826412 CAGATGACCCTACATAATGTAGG - Intergenic
1100339935 12:93669259-93669281 CAGTAGGCAGTCAAAAATGTGGG - Intergenic
1100699362 12:97129939-97129961 AAGTAAACCCTCCACAATGTGGG + Intergenic
1101091019 12:101285580-101285602 CAGCAGACCCTCAAAAAAGTAGG - Exonic
1101900319 12:108787171-108787193 CAGCAGACACTCAACAATGCAGG + Exonic
1106526290 13:30543791-30543813 CTGTAAACTCTCAATAAGGTAGG - Intronic
1107148886 13:37089661-37089683 CAGATAACCCTCCATAATGTGGG + Intergenic
1107650321 13:42538425-42538447 CAGATCACCCTCCATAATGTGGG + Intergenic
1107672379 13:42759359-42759381 CAGATTACCCTCCATAATGTGGG - Intergenic
1107857020 13:44626345-44626367 GAGGTTACCCTCAATAATGTGGG + Intergenic
1107990549 13:45815295-45815317 CAGATGGCCCTCCATAATGTGGG + Intronic
1109848485 13:68029647-68029669 CAGTATCCCCTCAATAATCTTGG - Intergenic
1110280013 13:73682005-73682027 CAGATGACCCCCCATAATGTGGG - Intergenic
1110557825 13:76880067-76880089 CAGTAGTCCCACAATAATTTGGG + Intergenic
1111598759 13:90445230-90445252 CAGATTACCCTCCATAATGTGGG + Intergenic
1111847637 13:93531500-93531522 GAGATCACCCTCAATAATGTGGG - Intronic
1113394844 13:109937797-109937819 TAGATGACCCTCCATAATGTCGG - Intergenic
1114683151 14:24504416-24504438 CAGTACACCCTCAGAAATGATGG + Intronic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1114870540 14:26650683-26650705 CAGTTTACCATCCATAATGTGGG + Intergenic
1115101062 14:29700710-29700732 CAGTTTACCCTCCATAATATGGG + Intronic
1115667301 14:35565448-35565470 CAGATTACCCTCTATAATGTGGG + Intronic
1116281826 14:42917905-42917927 CAGTAGACTCACAGTAATTTGGG - Intergenic
1116286383 14:42977631-42977653 GAGTAAACCCTCAAAAATTTAGG + Intergenic
1117194443 14:53325515-53325537 CAGTTTGCTCTCAATAATGTAGG - Intergenic
1117717637 14:58597370-58597392 CAGATTACCCTCCATAATGTGGG - Intergenic
1119344257 14:73909249-73909271 CATTAGACTCTGAATAAAGTTGG + Intronic
1120916653 14:89716466-89716488 CAGATGACCTTCCATAATGTGGG + Intergenic
1121239568 14:92419054-92419076 AAGATTACCCTCAATAATGTGGG - Intronic
1129368317 15:75070662-75070684 CAGTTGTCCCTCAGAAATGTGGG + Intronic
1130682797 15:86011061-86011083 CAGATTACCCTCCATAATGTGGG + Intergenic
1131153045 15:90058926-90058948 CAGATGACCCTCCATAATGTGGG - Intronic
1139094014 16:63683144-63683166 CAGATTACCCTCCATAATGTGGG - Intergenic
1139701945 16:68713274-68713296 CAGTTGACCCTCAATAAAGGGGG + Intronic
1141825752 16:86478700-86478722 CAGTGGACCCTGAACAACGTAGG - Intergenic
1142144287 16:88486360-88486382 CAGTAGACCCTCTGTGAAGTGGG + Intronic
1148850859 17:50554433-50554455 CAGCAGACCCTCAAGCAGGTGGG + Exonic
1149321228 17:55483475-55483497 CAGATGACCCTCCATCATGTGGG + Intergenic
1150502716 17:65666396-65666418 CAGCAGATCGTCAGTAATGTTGG - Intronic
1151131336 17:71900095-71900117 CAGGAGACATTCAACAATGTCGG + Intergenic
1153121716 18:1736191-1736213 CAGTAGGCCCTAGAAAATGTTGG - Intergenic
1155743205 18:29316254-29316276 CAGGTTACCCTCCATAATGTGGG + Intergenic
1157046721 18:44109079-44109101 CAGATTACCCTCCATAATGTAGG + Intergenic
1157801627 18:50626140-50626162 CAGATGACCCTTCATAATGTGGG - Intronic
1158671473 18:59478016-59478038 CAGATGACCCTCCATAATGCGGG + Intronic
1160478287 18:79214146-79214168 AAGTAGACTTTCAAAAATGTTGG + Intronic
1163710395 19:18843202-18843224 CAGGAGGCCCTCAACATTGTTGG - Intronic
925857883 2:8148191-8148213 CAGATGACCCTCCATAGTGTGGG - Intergenic
926343369 2:11923247-11923269 CAGATGACCCTCTATAATGTGGG - Intergenic
928675080 2:33642846-33642868 CAGTTGACCTTGAATGATGTGGG + Intergenic
929285517 2:40131042-40131064 TAGTAGACCCTTAAAAATGTTGG - Intronic
934667227 2:96180835-96180857 CAGTAGATGCTCAATAATGGTGG + Intergenic
935498298 2:103807971-103807993 CATATGACCCTCCATAATGTGGG - Intergenic
935507329 2:103921697-103921719 CAGTAGCCCTTCAATATAGTTGG + Intergenic
935668888 2:105538570-105538592 CAGATGACCCTCCATAATGTGGG + Intergenic
937134629 2:119542227-119542249 CAGTAGACCTTGATTAATCTAGG - Intergenic
937942238 2:127294927-127294949 CAGATTACCCTCAATAATGCGGG + Intergenic
939045831 2:137248708-137248730 CAGCAGACCCTCTATTATTTGGG - Intronic
940047672 2:149426789-149426811 CAGAAAACCCTTAATAATGTGGG + Intronic
941881960 2:170489802-170489824 CAGATTACCCTCTATAATGTGGG - Intronic
947941062 2:234055379-234055401 CAGATGACCCTCCATTATGTGGG - Intronic
1169338689 20:4779375-4779397 CAGTCTGCCCTCCATAATGTGGG - Intergenic
1171058988 20:21937555-21937577 CAGCAGTTCCTGAATAATGTTGG + Intergenic
1172040187 20:32039038-32039060 TAGTAAATGCTCAATAATGTTGG - Intergenic
1178522489 21:33298112-33298134 CAGATTACCCTCCATAATGTGGG - Intergenic
1179140984 21:38725027-38725049 CAGATGACCCTCTATAATGTGGG - Intergenic
1181263860 22:21618661-21618683 CACTACAGCCTCAATATTGTGGG + Intronic
1183783506 22:40015316-40015338 CAGATTACCCTCCATAATGTGGG - Intronic
1184458431 22:44624307-44624329 CAGTAGACCCTCCAGAGTGGGGG + Intergenic
1185147097 22:49143997-49144019 CAGTTGACCCTCCACAATGCCGG + Intergenic
949840264 3:8312529-8312551 TAGATTACCCTCAATAATGTAGG + Intergenic
951001700 3:17569297-17569319 CAGAAGTTCCTCCATAATGTAGG + Intronic
951626217 3:24666704-24666726 CATCAGACCCTCAATCATGATGG + Intergenic
953872617 3:46640403-46640425 CAGGAGACCCTCAATAACAGGGG - Intergenic
955121022 3:56058598-56058620 CAGATTACCCTCCATAATGTGGG + Intronic
956428769 3:69163875-69163897 CAGTAGCCCTTCAATTATGATGG - Intergenic
958437245 3:94112145-94112167 CAGATGGCCCTCCATAATGTGGG - Intronic
958488372 3:94741276-94741298 CAGATTACCCTCCATAATGTGGG - Intergenic
958931718 3:100214643-100214665 CAGATGGCCCTCCATAATGTGGG - Intergenic
964172548 3:153788340-153788362 CAATATACCCTTAAAAATGTGGG - Intergenic
964817532 3:160732462-160732484 CAGGAGACCTTCAATCATGGTGG - Intergenic
965376791 3:167934672-167934694 CAGATGACTCTCCATAATGTGGG - Intergenic
966064415 3:175800676-175800698 CAGTAGACCCTCAATAATGTTGG - Intronic
966270999 3:178105564-178105586 CAGATTACCCTCAATAACGTGGG + Intergenic
969136214 4:5031149-5031171 CAGATGACACTCCATAATGTGGG - Intergenic
970271689 4:14354827-14354849 CAGATTACCCTCCATAATGTGGG + Intergenic
970855381 4:20645098-20645120 AAGTAGACCCTCAAAACTGTAGG - Intergenic
971139841 4:23912552-23912574 CAGATGACCCTCCATAATATGGG + Intergenic
972112514 4:35582198-35582220 CAATAGACTCTCAGAAATGTTGG - Intergenic
972155017 4:36149446-36149468 GAGTATGACCTCAATAATGTAGG - Intronic
976395300 4:84549357-84549379 CAGACTACCCTCCATAATGTGGG + Intergenic
976531851 4:86163933-86163955 CAGGAGAAGATCAATAATGTGGG - Intronic
976775449 4:88700923-88700945 CAGGTTACCCTCCATAATGTGGG - Intronic
977788011 4:101062719-101062741 AAGTAGTTCATCAATAATGTAGG - Intronic
977835319 4:101639014-101639036 CAATGGGCCCTCAATAAGGTGGG + Intronic
977835498 4:101641159-101641181 CAGTGGGCCTTCAATAAGGTGGG + Intronic
977899658 4:102404851-102404873 CAGATTACCCTCCATAATGTGGG - Intronic
977917668 4:102612178-102612200 CAGTAGACCCTGGATAATGCTGG - Intronic
978146019 4:105372530-105372552 CAGATTACCCTCCATAATGTTGG + Intronic
978468738 4:109038248-109038270 CAGATTTCCCTCAATAATGTGGG + Intronic
978965923 4:114741642-114741664 CAGAAGACCTTCACTCATGTGGG + Intergenic
979098817 4:116588844-116588866 AAGTAGACCCACTAGAATGTGGG + Intergenic
979217634 4:118184344-118184366 CAGATTACCCTCCATAATGTGGG + Intronic
980771703 4:137381407-137381429 CAGATTACCCTCCATAATGTGGG + Intergenic
981343103 4:143645472-143645494 CAGATTACCCTCCATAATGTTGG + Intronic
983159010 4:164387069-164387091 CAGTAGAGCATCAATAATTGAGG - Intergenic
984201813 4:176731462-176731484 CAGTCACACCTCAATAATGTTGG + Intronic
985093679 4:186390502-186390524 CAGGTTGCCCTCAATAATGTAGG - Intergenic
988363537 5:30266546-30266568 CAGATTACCCTCTATAATGTGGG - Intergenic
990205011 5:53419520-53419542 CAGTAGGACCACAGTAATGTGGG - Intergenic
991052250 5:62285725-62285747 CAGCAGATCAGCAATAATGTAGG - Intergenic
992907093 5:81357214-81357236 CTGTAGACTCTAAGTAATGTGGG - Intronic
993045288 5:82859423-82859445 CAGTAAGCCCACAATAATGGTGG + Intergenic
995251913 5:110003080-110003102 CAGACTACCCTCTATAATGTGGG - Intergenic
995773395 5:115697911-115697933 CAGATTACCCTCCATAATGTGGG + Intergenic
997391181 5:133517927-133517949 CAGATTACCCTCCATAATGTGGG - Intronic
997595690 5:135105816-135105838 CAGTAGATGCTCAAGAATGTTGG - Intronic
998776602 5:145610197-145610219 CAGTAGAACCTCTTCAATGTGGG - Intronic
999168538 5:149572687-149572709 CAGATTACCCTCCATAATGTGGG + Intronic
1001285544 5:170420717-170420739 CAGTTGACCCTGAACGATGTGGG - Intronic
1001905904 5:175472969-175472991 AAGATTACCCTCAATAATGTGGG + Intergenic
1003030882 6:2599512-2599534 CAGAACACCCTGACTAATGTAGG - Intergenic
1003030913 6:2599789-2599811 CAGATGACCCTCCATGATGTGGG - Intergenic
1003409858 6:5852488-5852510 CAGGTGACCCTTCATAATGTGGG - Intergenic
1004291872 6:14374801-14374823 GAGATGACCCTTAATAATGTGGG + Intergenic
1004321484 6:14634880-14634902 CAGGTTACCCTGAATAATGTGGG + Intergenic
1007164295 6:39817815-39817837 CAGATTACCCTCCATAATGTGGG - Intronic
1007174954 6:39889603-39889625 AAGTTGACCCTTAATAATGTGGG + Intronic
1008416812 6:51250534-51250556 CAGTGGACTCTGAATACTGTGGG + Intergenic
1009578476 6:65498514-65498536 GATTAGCCCCACAATAATGTGGG - Intronic
1009730106 6:67591165-67591187 CAGATTACCCTCCATAATGTTGG - Intergenic
1011703296 6:89975538-89975560 CAGTAGGTACTCAATAAAGTTGG + Intronic
1012321526 6:97853370-97853392 CAAACTACCCTCAATAATGTGGG + Intergenic
1013113985 6:107086671-107086693 GAATAGTCCTTCAATAATGTCGG - Intronic
1013661850 6:112306122-112306144 CACTAGATGCTCAATATTGTAGG - Intergenic
1013799095 6:113919763-113919785 GAGTGCACCCTCTATAATGTAGG - Intergenic
1016284604 6:142459123-142459145 CAGATTACCCTCTATAATGTGGG - Intergenic
1016358100 6:143239514-143239536 CAGCAGCCCCTGAAGAATGTAGG + Intronic
1016574334 6:145550982-145551004 CAGTTGACCTTCATTAATGTGGG - Intronic
1016742582 6:147543492-147543514 CAGTATATCCTGCATAATGTGGG - Intronic
1017125368 6:151059586-151059608 GAGCAGAGCCTCAATACTGTGGG - Intronic
1017966284 6:159269851-159269873 CAGGTGACCCTCCATATTGTGGG - Intronic
1018198203 6:161373184-161373206 GAGATGACCCTCTATAATGTGGG - Intronic
1018423051 6:163655898-163655920 CAGATGATGCTCAATAATGTGGG + Intergenic
1019905830 7:4063854-4063876 CAGGATACCTTCAATAATTTTGG + Intronic
1022994949 7:35745853-35745875 CAGTAGGAGCTCAATAATATTGG + Intergenic
1023211012 7:37804765-37804787 CACTAGCTCCTCAATGATGTAGG + Intronic
1023280514 7:38564588-38564610 CAGGAGACCCTCAAAGATGCTGG + Intronic
1024730335 7:52246680-52246702 CAGATGACCCTTCATAATGTGGG - Intergenic
1029032702 7:97485659-97485681 CAGTAAACCCTCACTCTTGTAGG - Intergenic
1031628527 7:124018726-124018748 TTGTAAACTCTCAATAATGTTGG + Intergenic
1039253246 8:35689753-35689775 CAGACGGCCCTCCATAATGTGGG - Intronic
1039292748 8:36113949-36113971 CAGATTACCCTCCATAATGTGGG - Intergenic
1041160526 8:55037871-55037893 CAGTTGACCCTGAATGACGTGGG - Intergenic
1042260413 8:66853714-66853736 CAGTATAACCTCAATTCTGTGGG - Intronic
1042699902 8:71600864-71600886 CAGAAGAACCTCATTAATGGTGG - Intergenic
1042881608 8:73498961-73498983 CAGATTACCCTCCATAATGTGGG + Intronic
1046453626 8:114428144-114428166 CAGTAGACACACAATTATGCAGG + Intergenic
1046654285 8:116875241-116875263 CAGAAGACCCTCTATAATATAGG - Intergenic
1048315615 8:133359558-133359580 AAGTAGACACTCAGTAATGGTGG - Intergenic
1050344772 9:4675614-4675636 CAGTAGACACTCAATAAATGTGG - Intergenic
1052486552 9:29108477-29108499 CAGTAAGTTCTCAATAATGTAGG + Intergenic
1052683380 9:31723361-31723383 AAGAACACCCTCACTAATGTGGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055067424 9:72132697-72132719 CAGTAAAACCTCAATAGTCTGGG - Intronic
1056076333 9:83044856-83044878 CAGTTTACCCTCCATAATGTGGG + Intronic
1056697270 9:88870632-88870654 CAGAAGACCCTCAAGAATCCAGG + Intergenic
1057623778 9:96659578-96659600 CAGATTACCCTCCATAATGTGGG - Intergenic
1059351178 9:113666029-113666051 CTGTAGACCCCCAAGCATGTGGG + Intergenic
1059527098 9:115002207-115002229 CAGATGACCCTACATAATGTGGG - Intergenic
1188478172 X:30609178-30609200 CAGATTACCCTCCATAATGTGGG - Intergenic
1189359174 X:40336046-40336068 CAGATTACCCTCCATAATGTGGG + Intergenic
1191146348 X:57169629-57169651 CAGATTACTCTCAATAATGTAGG + Intergenic
1191591190 X:62887406-62887428 CAGTAGACACTCAAGAGAGTGGG - Intergenic
1191673562 X:63771524-63771546 CAGAATACCCTGCATAATGTAGG + Intronic
1193571677 X:83151996-83152018 CAGTAAAGCCTCAGTTATGTTGG - Intergenic
1194087622 X:89548256-89548278 CAGAATGCCCTCTATAATGTGGG - Intergenic
1195769273 X:108331808-108331830 CAGATTACCCTCCATAATGTGGG - Intronic
1198105569 X:133458117-133458139 CAGATTACCCTCTATAATGTGGG - Intergenic
1198378510 X:136062486-136062508 CAGTAGACACTCATGAATCTTGG - Intergenic
1199183325 X:144884357-144884379 CAGATGACCCTCCATAATATGGG + Intergenic
1199808199 X:151323052-151323074 TAGTAGATTCTCAAAAATGTTGG + Intergenic
1200016874 X:153171468-153171490 CAGTTTACCCTCCATAATGTTGG - Intergenic
1200305826 X:155025135-155025157 CTGTAGAACCTCAAACATGTTGG - Intronic
1200440265 Y:3204126-3204148 CAGAATGCCCTCTATAATGTGGG - Intergenic
1201455129 Y:14160966-14160988 CAATTGACCCTCAAAAGTGTTGG - Intergenic