ID: 966066372

View in Genome Browser
Species Human (GRCh38)
Location 3:175826791-175826813
Sequence AGAAGGATGAGAAAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066372_966066381 13 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data
966066372_966066376 -8 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066376 3:175826806-175826828 ATCCTTCTGCTCCAAGCCATTGG No data
966066372_966066382 23 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066372_966066383 27 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066383 3:175826841-175826863 CTGTACTGGAGAAAGAAGGAAGG No data
966066372_966066378 1 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066378 3:175826815-175826837 CTCCAAGCCATTGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066372 Original CRISPR AGAAGGATGAGAAAGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr