ID: 966066374

View in Genome Browser
Species Human (GRCh38)
Location 3:175826797-175826819
Sequence TGGAGCAGAAGGATGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066374_966066382 17 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066374_966066378 -5 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066378 3:175826815-175826837 CTCCAAGCCATTGGAGACAAAGG No data
966066374_966066383 21 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066383 3:175826841-175826863 CTGTACTGGAGAAAGAAGGAAGG No data
966066374_966066381 7 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066374 Original CRISPR TGGAGCAGAAGGATGAGAAA GGG (reversed) Intergenic
No off target data available for this crispr