ID: 966066377

View in Genome Browser
Species Human (GRCh38)
Location 3:175826808-175826830
Sequence CTCCAATGGCTTGGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066377_966066381 -4 Left 966066377 3:175826808-175826830 CCTTCTGCTCCAAGCCATTGGAG No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data
966066377_966066382 6 Left 966066377 3:175826808-175826830 CCTTCTGCTCCAAGCCATTGGAG No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066377_966066383 10 Left 966066377 3:175826808-175826830 CCTTCTGCTCCAAGCCATTGGAG No data
Right 966066383 3:175826841-175826863 CTGTACTGGAGAAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066377 Original CRISPR CTCCAATGGCTTGGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr