ID: 966066378

View in Genome Browser
Species Human (GRCh38)
Location 3:175826815-175826837
Sequence CTCCAAGCCATTGGAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066372_966066378 1 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066378 3:175826815-175826837 CTCCAAGCCATTGGAGACAAAGG No data
966066373_966066378 -2 Left 966066373 3:175826794-175826816 CCTCCCTTTCTCATCCTTCTGCT No data
Right 966066378 3:175826815-175826837 CTCCAAGCCATTGGAGACAAAGG No data
966066375_966066378 -6 Left 966066375 3:175826798-175826820 CCTTTCTCATCCTTCTGCTCCAA No data
Right 966066378 3:175826815-175826837 CTCCAAGCCATTGGAGACAAAGG No data
966066374_966066378 -5 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066378 3:175826815-175826837 CTCCAAGCCATTGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066378 Original CRISPR CTCCAAGCCATTGGAGACAA AGG Intergenic
No off target data available for this crispr