ID: 966066379

View in Genome Browser
Species Human (GRCh38)
Location 3:175826817-175826839
Sequence AACCTTTGTCTCCAATGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066379_966066382 -3 Left 966066379 3:175826817-175826839 CCAAGCCATTGGAGACAAAGGTT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066379_966066383 1 Left 966066379 3:175826817-175826839 CCAAGCCATTGGAGACAAAGGTT No data
Right 966066383 3:175826841-175826863 CTGTACTGGAGAAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066379 Original CRISPR AACCTTTGTCTCCAATGGCT TGG (reversed) Intergenic
No off target data available for this crispr