ID: 966066380

View in Genome Browser
Species Human (GRCh38)
Location 3:175826822-175826844
Sequence ACAGAAACCTTTGTCTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066380_966066383 -4 Left 966066380 3:175826822-175826844 CCATTGGAGACAAAGGTTTCTGT No data
Right 966066383 3:175826841-175826863 CTGTACTGGAGAAAGAAGGAAGG No data
966066380_966066382 -8 Left 966066380 3:175826822-175826844 CCATTGGAGACAAAGGTTTCTGT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066380 Original CRISPR ACAGAAACCTTTGTCTCCAA TGG (reversed) Intergenic
No off target data available for this crispr