ID: 966066381

View in Genome Browser
Species Human (GRCh38)
Location 3:175826827-175826849
Sequence GGAGACAAAGGTTTCTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066373_966066381 10 Left 966066373 3:175826794-175826816 CCTCCCTTTCTCATCCTTCTGCT No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data
966066374_966066381 7 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data
966066377_966066381 -4 Left 966066377 3:175826808-175826830 CCTTCTGCTCCAAGCCATTGGAG No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data
966066372_966066381 13 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data
966066375_966066381 6 Left 966066375 3:175826798-175826820 CCTTTCTCATCCTTCTGCTCCAA No data
Right 966066381 3:175826827-175826849 GGAGACAAAGGTTTCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066381 Original CRISPR GGAGACAAAGGTTTCTGTAC TGG Intergenic
No off target data available for this crispr