ID: 966066382

View in Genome Browser
Species Human (GRCh38)
Location 3:175826837-175826859
Sequence GTTTCTGTACTGGAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966066375_966066382 16 Left 966066375 3:175826798-175826820 CCTTTCTCATCCTTCTGCTCCAA No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066380_966066382 -8 Left 966066380 3:175826822-175826844 CCATTGGAGACAAAGGTTTCTGT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066372_966066382 23 Left 966066372 3:175826791-175826813 CCTCCTCCCTTTCTCATCCTTCT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066377_966066382 6 Left 966066377 3:175826808-175826830 CCTTCTGCTCCAAGCCATTGGAG No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066373_966066382 20 Left 966066373 3:175826794-175826816 CCTCCCTTTCTCATCCTTCTGCT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066374_966066382 17 Left 966066374 3:175826797-175826819 CCCTTTCTCATCCTTCTGCTCCA No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data
966066379_966066382 -3 Left 966066379 3:175826817-175826839 CCAAGCCATTGGAGACAAAGGTT No data
Right 966066382 3:175826837-175826859 GTTTCTGTACTGGAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966066382 Original CRISPR GTTTCTGTACTGGAGAAAGA AGG Intergenic
No off target data available for this crispr