ID: 966072630

View in Genome Browser
Species Human (GRCh38)
Location 3:175897256-175897278
Sequence CTCTTAGTTTGCAGTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966072628_966072630 29 Left 966072628 3:175897204-175897226 CCATACGATATATACCAAATAAT No data
Right 966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG No data
966072627_966072630 30 Left 966072627 3:175897203-175897225 CCCATACGATATATACCAAATAA No data
Right 966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG No data
966072629_966072630 15 Left 966072629 3:175897218-175897240 CCAAATAATGAAAATAATAAAAG No data
Right 966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966072630 Original CRISPR CTCTTAGTTTGCAGTGATGA AGG Intergenic
No off target data available for this crispr