ID: 966075783

View in Genome Browser
Species Human (GRCh38)
Location 3:175935602-175935624
Sequence CAAAATGCAGGTAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966075779_966075783 4 Left 966075779 3:175935575-175935597 CCTAGAGACTTGTTGAATGGTTG 0: 64
1: 511
2: 2122
3: 2008
4: 1248
Right 966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966075783 Original CRISPR CAAAATGCAGGTAGTGATAT GGG Intergenic
No off target data available for this crispr