ID: 966086812

View in Genome Browser
Species Human (GRCh38)
Location 3:176078349-176078371
Sequence CCTACAATTTTGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966086812_966086821 19 Left 966086812 3:176078349-176078371 CCCTTCTCCTTCAAAATTGTAGG No data
Right 966086821 3:176078391-176078413 TCTTACCTCACTACATTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966086812 Original CRISPR CCTACAATTTTGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr