ID: 966089186

View in Genome Browser
Species Human (GRCh38)
Location 3:176110034-176110056
Sequence TTTCTTTTAAGCAGCTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966089183_966089186 17 Left 966089183 3:176109994-176110016 CCAAGTCAAACAGTTTCCAGGAA No data
Right 966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG No data
966089184_966089186 1 Left 966089184 3:176110010-176110032 CCAGGAAGTTTATGATGATCATC No data
Right 966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966089186 Original CRISPR TTTCTTTTAAGCAGCTCCTA TGG Intergenic
No off target data available for this crispr