ID: 966090605

View in Genome Browser
Species Human (GRCh38)
Location 3:176130860-176130882
Sequence ACATATATTCAAAAATCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966090604_966090605 2 Left 966090604 3:176130835-176130857 CCATTTCTGTTTAGACATACACT No data
Right 966090605 3:176130860-176130882 ACATATATTCAAAAATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966090605 Original CRISPR ACATATATTCAAAAATCTGA AGG Intergenic
No off target data available for this crispr