ID: 966094317

View in Genome Browser
Species Human (GRCh38)
Location 3:176180401-176180423
Sequence TCAAATGTGAGGCTTACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966094317_966094322 -9 Left 966094317 3:176180401-176180423 CCCCAGGTAAGCCTCACATTTGA No data
Right 966094322 3:176180415-176180437 CACATTTGATGTAGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966094317 Original CRISPR TCAAATGTGAGGCTTACCTG GGG (reversed) Intergenic