ID: 966094318 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:176180402-176180424 |
| Sequence | ATCAAATGTGAGGCTTACCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966094318_966094322 | -10 | Left | 966094318 | 3:176180402-176180424 | CCCAGGTAAGCCTCACATTTGAT | No data | ||
| Right | 966094322 | 3:176180415-176180437 | CACATTTGATGTAGTCATGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966094318 | Original CRISPR | ATCAAATGTGAGGCTTACCT GGG (reversed) | Intergenic | ||