ID: 966094322

View in Genome Browser
Species Human (GRCh38)
Location 3:176180415-176180437
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966094317_966094322 -9 Left 966094317 3:176180401-176180423 CCCCAGGTAAGCCTCACATTTGA No data
Right 966094322 3:176180415-176180437 CACATTTGATGTAGTCATGGAGG No data
966094318_966094322 -10 Left 966094318 3:176180402-176180424 CCCAGGTAAGCCTCACATTTGAT No data
Right 966094322 3:176180415-176180437 CACATTTGATGTAGTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type