ID: 966101204

View in Genome Browser
Species Human (GRCh38)
Location 3:176270467-176270489
Sequence CTTCATCTACTCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966101204_966101209 14 Left 966101204 3:176270467-176270489 CCTTCCACCTTGAGTAGATGAAG No data
Right 966101209 3:176270504-176270526 CAGAAGCCAAACTGGCACCATGG No data
966101204_966101207 6 Left 966101204 3:176270467-176270489 CCTTCCACCTTGAGTAGATGAAG No data
Right 966101207 3:176270496-176270518 ATTCTCGCCAGAAGCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966101204 Original CRISPR CTTCATCTACTCAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr