ID: 966101204 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:176270467-176270489 |
| Sequence | CTTCATCTACTCAAGGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966101204_966101209 | 14 | Left | 966101204 | 3:176270467-176270489 | CCTTCCACCTTGAGTAGATGAAG | No data | ||
| Right | 966101209 | 3:176270504-176270526 | CAGAAGCCAAACTGGCACCATGG | No data | ||||
| 966101204_966101207 | 6 | Left | 966101204 | 3:176270467-176270489 | CCTTCCACCTTGAGTAGATGAAG | No data | ||
| Right | 966101207 | 3:176270496-176270518 | ATTCTCGCCAGAAGCCAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966101204 | Original CRISPR | CTTCATCTACTCAAGGTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||