ID: 966112060

View in Genome Browser
Species Human (GRCh38)
Location 3:176414922-176414944
Sequence ATCATAGAAAAGTCAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966112060_966112068 27 Left 966112060 3:176414922-176414944 CCTGTTACTGACTTTTCTATGAT No data
Right 966112068 3:176414972-176414994 CTCAGTGACTCCTACAATTGTGG No data
966112060_966112069 28 Left 966112060 3:176414922-176414944 CCTGTTACTGACTTTTCTATGAT No data
Right 966112069 3:176414973-176414995 TCAGTGACTCCTACAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966112060 Original CRISPR ATCATAGAAAAGTCAGTAAC AGG (reversed) Intergenic