ID: 966112060 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:176414922-176414944 |
Sequence | ATCATAGAAAAGTCAGTAAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
966112060_966112068 | 27 | Left | 966112060 | 3:176414922-176414944 | CCTGTTACTGACTTTTCTATGAT | No data | ||
Right | 966112068 | 3:176414972-176414994 | CTCAGTGACTCCTACAATTGTGG | No data | ||||
966112060_966112069 | 28 | Left | 966112060 | 3:176414922-176414944 | CCTGTTACTGACTTTTCTATGAT | No data | ||
Right | 966112069 | 3:176414973-176414995 | TCAGTGACTCCTACAATTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
966112060 | Original CRISPR | ATCATAGAAAAGTCAGTAAC AGG (reversed) | Intergenic | ||