ID: 966112061

View in Genome Browser
Species Human (GRCh38)
Location 3:176414945-176414967
Sequence GGGGATCTGAAAGGAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966112061_966112069 5 Left 966112061 3:176414945-176414967 CCTCTAACTCCTTTCAGATCCCC No data
Right 966112069 3:176414973-176414995 TCAGTGACTCCTACAATTGTGGG No data
966112061_966112068 4 Left 966112061 3:176414945-176414967 CCTCTAACTCCTTTCAGATCCCC No data
Right 966112068 3:176414972-176414994 CTCAGTGACTCCTACAATTGTGG No data
966112061_966112070 11 Left 966112061 3:176414945-176414967 CCTCTAACTCCTTTCAGATCCCC No data
Right 966112070 3:176414979-176415001 ACTCCTACAATTGTGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966112061 Original CRISPR GGGGATCTGAAAGGAGTTAG AGG (reversed) Intergenic
No off target data available for this crispr