ID: 966112068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:176414972-176414994 |
Sequence | CTCAGTGACTCCTACAATTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
966112062_966112068 | -5 | Left | 966112062 | 3:176414954-176414976 | CCTTTCAGATCCCCATCCCTCAG | No data | ||
Right | 966112068 | 3:176414972-176414994 | CTCAGTGACTCCTACAATTGTGG | No data | ||||
966112061_966112068 | 4 | Left | 966112061 | 3:176414945-176414967 | CCTCTAACTCCTTTCAGATCCCC | No data | ||
Right | 966112068 | 3:176414972-176414994 | CTCAGTGACTCCTACAATTGTGG | No data | ||||
966112060_966112068 | 27 | Left | 966112060 | 3:176414922-176414944 | CCTGTTACTGACTTTTCTATGAT | No data | ||
Right | 966112068 | 3:176414972-176414994 | CTCAGTGACTCCTACAATTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
966112068 | Original CRISPR | CTCAGTGACTCCTACAATTG TGG | Intergenic | ||