ID: 966112069

View in Genome Browser
Species Human (GRCh38)
Location 3:176414973-176414995
Sequence TCAGTGACTCCTACAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966112060_966112069 28 Left 966112060 3:176414922-176414944 CCTGTTACTGACTTTTCTATGAT No data
Right 966112069 3:176414973-176414995 TCAGTGACTCCTACAATTGTGGG No data
966112062_966112069 -4 Left 966112062 3:176414954-176414976 CCTTTCAGATCCCCATCCCTCAG No data
Right 966112069 3:176414973-176414995 TCAGTGACTCCTACAATTGTGGG No data
966112061_966112069 5 Left 966112061 3:176414945-176414967 CCTCTAACTCCTTTCAGATCCCC No data
Right 966112069 3:176414973-176414995 TCAGTGACTCCTACAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966112069 Original CRISPR TCAGTGACTCCTACAATTGT GGG Intergenic
No off target data available for this crispr