ID: 966112070

View in Genome Browser
Species Human (GRCh38)
Location 3:176414979-176415001
Sequence ACTCCTACAATTGTGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966112065_966112070 -10 Left 966112065 3:176414966-176414988 CCATCCCTCAGTGACTCCTACAA No data
Right 966112070 3:176414979-176415001 ACTCCTACAATTGTGGGAACTGG No data
966112063_966112070 -8 Left 966112063 3:176414964-176414986 CCCCATCCCTCAGTGACTCCTAC No data
Right 966112070 3:176414979-176415001 ACTCCTACAATTGTGGGAACTGG No data
966112062_966112070 2 Left 966112062 3:176414954-176414976 CCTTTCAGATCCCCATCCCTCAG No data
Right 966112070 3:176414979-176415001 ACTCCTACAATTGTGGGAACTGG No data
966112061_966112070 11 Left 966112061 3:176414945-176414967 CCTCTAACTCCTTTCAGATCCCC No data
Right 966112070 3:176414979-176415001 ACTCCTACAATTGTGGGAACTGG No data
966112064_966112070 -9 Left 966112064 3:176414965-176414987 CCCATCCCTCAGTGACTCCTACA No data
Right 966112070 3:176414979-176415001 ACTCCTACAATTGTGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966112070 Original CRISPR ACTCCTACAATTGTGGGAAC TGG Intergenic
No off target data available for this crispr