ID: 966113833

View in Genome Browser
Species Human (GRCh38)
Location 3:176436811-176436833
Sequence TCCCTTTAGGTCCCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966113831_966113833 -4 Left 966113831 3:176436792-176436814 CCACTGTCTCAGATGCTTTTCCC No data
Right 966113833 3:176436811-176436833 TCCCTTTAGGTCCCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966113833 Original CRISPR TCCCTTTAGGTCCCTCCTAC TGG Intergenic
No off target data available for this crispr