ID: 966116323

View in Genome Browser
Species Human (GRCh38)
Location 3:176467654-176467676
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966116321_966116323 10 Left 966116321 3:176467621-176467643 CCAGTGAACACAGGAATGATAAA 0: 3
1: 57
2: 227
3: 565
4: 880
Right 966116323 3:176467654-176467676 CTCACTGCTGAGATAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr