ID: 966118801

View in Genome Browser
Species Human (GRCh38)
Location 3:176498777-176498799
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966118798_966118801 6 Left 966118798 3:176498748-176498770 CCTTCTTCACAAGGTGACAGGAG No data
Right 966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type