ID: 966119378

View in Genome Browser
Species Human (GRCh38)
Location 3:176505577-176505599
Sequence CAGTTTTAGCATCTGAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966119378_966119385 23 Left 966119378 3:176505577-176505599 CCCATGTTCAGATGCTAAAACTG No data
Right 966119385 3:176505623-176505645 ACCCCAGGTCACAAAGCAAGTGG No data
966119378_966119384 8 Left 966119378 3:176505577-176505599 CCCATGTTCAGATGCTAAAACTG No data
Right 966119384 3:176505608-176505630 AGGGGTAAGTAACTTACCCCAGG No data
966119378_966119383 -10 Left 966119378 3:176505577-176505599 CCCATGTTCAGATGCTAAAACTG No data
Right 966119383 3:176505590-176505612 GCTAAAACTGAGGCAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966119378 Original CRISPR CAGTTTTAGCATCTGAACAT GGG (reversed) Intergenic
No off target data available for this crispr