ID: 966148988

View in Genome Browser
Species Human (GRCh38)
Location 3:176845277-176845299
Sequence GGAGTCTTCGGAACTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966148976_966148988 28 Left 966148976 3:176845226-176845248 CCCCACACTAGAAATGAGACAAC No data
Right 966148988 3:176845277-176845299 GGAGTCTTCGGAACTTGGCCAGG No data
966148977_966148988 27 Left 966148977 3:176845227-176845249 CCCACACTAGAAATGAGACAACT No data
Right 966148988 3:176845277-176845299 GGAGTCTTCGGAACTTGGCCAGG No data
966148978_966148988 26 Left 966148978 3:176845228-176845250 CCACACTAGAAATGAGACAACTG No data
Right 966148988 3:176845277-176845299 GGAGTCTTCGGAACTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966148988 Original CRISPR GGAGTCTTCGGAACTTGGCC AGG Intergenic