ID: 966155332

View in Genome Browser
Species Human (GRCh38)
Location 3:176910190-176910212
Sequence CAGTGTGACCAAGAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966155332_966155336 19 Left 966155332 3:176910190-176910212 CCTGCTCCCTCTTGGTCACACTG No data
Right 966155336 3:176910232-176910254 ACAATGTTTCCCTTTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966155332 Original CRISPR CAGTGTGACCAAGAGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr