ID: 966158715

View in Genome Browser
Species Human (GRCh38)
Location 3:176945936-176945958
Sequence AAGATGAAACAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966158704_966158715 26 Left 966158704 3:176945887-176945909 CCATGAAGCCAGTCCCTGGTGCC 0: 13
1: 303
2: 613
3: 1167
4: 1554
Right 966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG No data
966158708_966158715 13 Left 966158708 3:176945900-176945922 CCCTGGTGCCCAAAAGTTTGGGG No data
Right 966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG No data
966158711_966158715 5 Left 966158711 3:176945908-176945930 CCCAAAAGTTTGGGGACTGCTGG 0: 13
1: 110
2: 654
3: 1165
4: 1740
Right 966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG No data
966158705_966158715 18 Left 966158705 3:176945895-176945917 CCAGTCCCTGGTGCCCAAAAGTT No data
Right 966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG No data
966158710_966158715 12 Left 966158710 3:176945901-176945923 CCTGGTGCCCAAAAGTTTGGGGA No data
Right 966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG No data
966158713_966158715 4 Left 966158713 3:176945909-176945931 CCAAAAGTTTGGGGACTGCTGGT No data
Right 966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966158715 Original CRISPR AAGATGAAACAGAATGAGGA AGG Intergenic
No off target data available for this crispr