ID: 966159605

View in Genome Browser
Species Human (GRCh38)
Location 3:176953972-176953994
Sequence CTGTGTGTTCTCAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966159605_966159606 12 Left 966159605 3:176953972-176953994 CCTTCTTCTCTGAGAACACACAG No data
Right 966159606 3:176954007-176954029 GACAGAGTCCAGATTCCAGTAGG No data
966159605_966159607 13 Left 966159605 3:176953972-176953994 CCTTCTTCTCTGAGAACACACAG No data
Right 966159607 3:176954008-176954030 ACAGAGTCCAGATTCCAGTAGGG No data
966159605_966159610 23 Left 966159605 3:176953972-176953994 CCTTCTTCTCTGAGAACACACAG No data
Right 966159610 3:176954018-176954040 GATTCCAGTAGGGCAGCCCAGGG No data
966159605_966159609 22 Left 966159605 3:176953972-176953994 CCTTCTTCTCTGAGAACACACAG No data
Right 966159609 3:176954017-176954039 AGATTCCAGTAGGGCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966159605 Original CRISPR CTGTGTGTTCTCAGAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr