ID: 966164259

View in Genome Browser
Species Human (GRCh38)
Location 3:176999412-176999434
Sequence CTGAGGATATAGAGGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966164256_966164259 19 Left 966164256 3:176999370-176999392 CCAATGGTTTTTTTATCATGAGT No data
Right 966164259 3:176999412-176999434 CTGAGGATATAGAGGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966164259 Original CRISPR CTGAGGATATAGAGGCAAAA AGG Intergenic
No off target data available for this crispr