ID: 966166756

View in Genome Browser
Species Human (GRCh38)
Location 3:177028077-177028099
Sequence CAGAGCTAAGACATTTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966166754_966166756 0 Left 966166754 3:177028054-177028076 CCAAAACATTATGGGCAACAAGG 0: 1
1: 0
2: 1
3: 4
4: 123
Right 966166756 3:177028077-177028099 CAGAGCTAAGACATTTAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966166756 Original CRISPR CAGAGCTAAGACATTTAAAA AGG Intronic
904734225 1:32618063-32618085 CAGAGCTAATTGATTTAAATGGG - Intronic
905911010 1:41654592-41654614 CAGAACTAAGACATTAACATTGG + Intronic
906239684 1:44235198-44235220 CAGAACTCAGACTTTTATAAAGG - Intronic
906436294 1:45799593-45799615 CAGAGCAAACACATCTAAAATGG + Intronic
908131092 1:61076401-61076423 AAGAGTTTTGACATTTAAAAGGG - Intronic
909286646 1:73828283-73828305 CATTCCTAAGAAATTTAAAATGG + Intergenic
909496275 1:76282563-76282585 CTGAACAAAGTCATTTAAAATGG + Intronic
910457093 1:87409595-87409617 CAGAGTTAATACTATTAAAATGG - Intergenic
911467112 1:98269536-98269558 CAGAGGTAATACATGTCAAATGG - Intergenic
911503734 1:98722663-98722685 AATAGATAAGCCATTTAAAAAGG + Intronic
912925656 1:113910962-113910984 TTGAGCTAAGACATATGAAAGGG - Intronic
913646113 1:120855971-120855993 AAAAGAAAAGACATTTAAAAAGG + Intergenic
913938330 1:125078192-125078214 CAGAGCCAAGACAATAACAATGG - Intergenic
913944505 1:125145864-125145886 CAGAGCCAAGACAATAACAATGG + Intergenic
913954674 1:143277911-143277933 CAGAGCCAAGACAATAACAATGG - Intergenic
913982762 1:143537454-143537476 CAGAGCCAAGACAATAACAATGG + Intergenic
914080531 1:144406912-144406934 AAAAGAAAAGACATTTAAAAAGG - Intergenic
914530160 1:148516912-148516934 AAAAGAAAAGACATTTAAAAAGG - Intergenic
914767923 1:150655599-150655621 CAGAGCCTATACCTTTAAAATGG + Intronic
914996133 1:152544701-152544723 CAGGGATAAGAAATCTAAAATGG + Intronic
915442899 1:155957123-155957145 CACAGGTAAGATGTTTAAAATGG - Intronic
916238045 1:162610320-162610342 CAGAGCTAATAAGTTTAACAAGG + Intergenic
916300869 1:163272674-163272696 CAGTGCCAAGACAATTCAAAGGG - Intronic
916745248 1:167680209-167680231 CAGATCTAAGACATGGAAAATGG + Intronic
918377975 1:183928371-183928393 CAAATTTAAGACATTTAAAGTGG - Exonic
918657139 1:187041711-187041733 CATAGCTATTATATTTAAAAGGG - Intergenic
918923541 1:190748085-190748107 CAGAGTTAAGATACTTATAAAGG - Intergenic
919238492 1:194878717-194878739 CAGAGCTCAGATAATGAAAAGGG - Intergenic
919936849 1:202257584-202257606 CAGTGCTAAGACAATTCAATAGG - Intronic
920455812 1:206100230-206100252 CAGATCTAAGACCATGAAAAAGG - Intronic
921526165 1:216221204-216221226 CAGAGTTAAGCCAATAAAAAGGG - Intronic
923284600 1:232481192-232481214 CCGAGCCAAGAGAATTAAAATGG - Intronic
924076412 1:240342509-240342531 CAGAGATACAACTTTTAAAAGGG - Intronic
924247851 1:242102437-242102459 GACAGCAAAGACATTTCAAAAGG + Intronic
1063988208 10:11530583-11530605 CAGGGATAAGACATTTCTAAGGG - Intronic
1064017766 10:11786075-11786097 CAGAGCTCAGATATTTAATCTGG + Intergenic
1065148422 10:22797029-22797051 CAGAGAAAAAACATTGAAAAGGG - Intergenic
1065738566 10:28775933-28775955 CAGAGCCAAACCATTTAAGATGG + Intergenic
1066949957 10:42107666-42107688 CAGAGCCAAGACAATAACAATGG - Intergenic
1067739360 10:48882767-48882789 CAGCACCAAGACATTTACAAGGG + Intronic
1068482963 10:57618055-57618077 CATAGCTAAGACATGCAAAATGG - Intergenic
1068571060 10:58629920-58629942 CAAAGCCTAGAAATTTAAAAGGG - Intronic
1068679313 10:59802327-59802349 CAGAGCCAATATGTTTAAAATGG + Intronic
1069369621 10:67733371-67733393 CAGACATAATACATCTAAAATGG + Intergenic
1070032362 10:72689657-72689679 CAGAGATACTACATTTAAAAAGG - Intergenic
1070293442 10:75137836-75137858 CAGAACTATAACACTTAAAATGG + Intronic
1070388890 10:75951602-75951624 CAGAGTGAAGAATTTTAAAAGGG - Intronic
1071239751 10:83692483-83692505 CAGAGCCAAGACATTCAAGGAGG - Intergenic
1072182224 10:92996669-92996691 CAGAGGCTAAACATTTAAAAAGG + Intronic
1072412641 10:95217627-95217649 CAGAACTAAGTCCTATAAAAAGG - Intronic
1073155365 10:101342130-101342152 CATAGCTATGGCATTCAAAAAGG - Intergenic
1073547748 10:104366193-104366215 TAGAGCTGGGAAATTTAAAAGGG - Intronic
1074754464 10:116614173-116614195 CAGTGCTAATAAAGTTAAAATGG - Intergenic
1075914174 10:126152908-126152930 ATGAGCTAATAGATTTAAAATGG - Intronic
1078857286 11:15216650-15216672 CAGAACCAGGACTTTTAAAATGG - Intronic
1080759248 11:35231755-35231777 CTGGGCTAAGTCATTTAAACTGG + Intronic
1081404048 11:42675738-42675760 TAGTGGAAAGACATTTAAAAAGG - Intergenic
1084472182 11:69369095-69369117 CAAAACTAAGACATTTACATTGG + Intergenic
1085151550 11:74256429-74256451 AAAAGCTCAGACATTTGAAATGG + Intronic
1085214136 11:74812971-74812993 AAGAGCAAAGACCTTGAAAAGGG - Intronic
1085655966 11:78315286-78315308 CAGTTCAAAGACATTAAAAAGGG - Intronic
1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG + Intergenic
1086416238 11:86591358-86591380 TAAAGATAAGTCATTTAAAAAGG + Intronic
1087334556 11:96826801-96826823 TAGAGATAGGACCTTTAAAATGG - Intergenic
1087700064 11:101426544-101426566 CACAGCTAACACATTAAACAGGG - Intergenic
1087971987 11:104495453-104495475 CAGAGCCAAGGTATTTAACAAGG + Intergenic
1089406149 11:118199335-118199357 CAGAGCAAAGACCTTTAGAGAGG + Intronic
1093334248 12:17881388-17881410 CAGAGCAAAGAAATTTACCAAGG + Intergenic
1093890874 12:24519072-24519094 CAGAGCTGAGAAATTGAGAACGG + Intergenic
1095433281 12:42157631-42157653 CAAAGTGAAAACATTTAAAAAGG - Exonic
1095966737 12:47872804-47872826 CAAAACTAAGACACTAAAAAGGG + Intronic
1096443569 12:51667744-51667766 CAGTTCTAAGAAATTAAAAAGGG - Intronic
1099046853 12:77731669-77731691 CGGAGCTAAAAGAGTTAAAATGG + Intergenic
1101034158 12:100688489-100688511 AACAATTAAGACATTTAAAAAGG + Intergenic
1101850390 12:108397323-108397345 CAGAGCTGTGACATTTAAATGGG + Intergenic
1104105575 12:125655902-125655924 CAGAGATAAAACATTGACAAGGG + Exonic
1105233957 13:18528141-18528163 CAGAGCCAAGACAATAACAATGG + Intergenic
1105400583 13:20090963-20090985 CAAAGCTAAGCAATTTAAAAAGG - Exonic
1105664840 13:22542420-22542442 CAGAGCCGAGCCATGTAAAAGGG - Intergenic
1105680442 13:22721243-22721265 CAGATCTAAGACATTTGAATTGG - Intergenic
1106090707 13:26590912-26590934 GAGAACTAAATCATTTAAAAAGG + Intronic
1107572611 13:41679068-41679090 CAGTGTTAAAACGTTTAAAATGG - Intronic
1107574227 13:41699734-41699756 TAGAGCTAAGATTTTTTAAATGG - Intronic
1110117161 13:71833278-71833300 CAGAGCTAGGTTATTTAAAGAGG + Intronic
1110923004 13:81112275-81112297 CATAGCTGAGATATGTAAAAGGG - Intergenic
1110963628 13:81662181-81662203 AAGAGCAAAAAAATTTAAAAAGG + Intergenic
1112525030 13:100137597-100137619 CAGAGCAAAGAAATTTACAAGGG - Intronic
1112525725 13:100145108-100145130 CATCTCTAAGACATTAAAAATGG + Intronic
1113161526 13:107387147-107387169 AATTTCTAAGACATTTAAAATGG - Intronic
1113559907 13:111270485-111270507 CAGAACAAATACAGTTAAAAAGG - Intronic
1114349210 14:21832018-21832040 GAGAGCTAGGAGAGTTAAAAGGG - Intergenic
1114821270 14:26022094-26022116 CAGAGTTAAAACATTTACAAAGG + Intergenic
1115155192 14:30331120-30331142 CAGAGCTTTGACTTCTAAAATGG + Intergenic
1115343958 14:32322270-32322292 CAGAGCTGAGACCCTTCAAAGGG - Intergenic
1115452661 14:33566033-33566055 CAGAGCTTCCACATTCAAAAGGG - Intronic
1115867665 14:37766130-37766152 CAGAAATAACACTTTTAAAATGG - Intronic
1116130558 14:40850759-40850781 CTGAACTAATACAGTTAAAATGG + Intergenic
1116657534 14:47672199-47672221 CATAGCTGTGACATTTATAATGG + Intronic
1117274312 14:54177190-54177212 AAAAGCAAAGACAATTAAAATGG - Intergenic
1117498527 14:56329567-56329589 CAAGGCCCAGACATTTAAAAAGG - Intergenic
1117735212 14:58762008-58762030 TAGAGCCAAAACATATAAAAAGG + Intergenic
1120344993 14:83276079-83276101 AAGAGATAAGTCATATAAAAAGG + Intergenic
1121029785 14:90648325-90648347 GAGAAATAAGACATGTAAAAGGG - Intronic
1121380842 14:93464496-93464518 CAGAGATAAGGCCTTTAAAAGGG - Intronic
1125089552 15:35774486-35774508 CAGAGAAATGAAATTTAAAAAGG - Intergenic
1125108298 15:36000249-36000271 CAAACCTAAGAGAATTAAAAGGG + Intergenic
1125127439 15:36240546-36240568 TAGGGATAATACATTTAAAATGG + Intergenic
1125162105 15:36656689-36656711 CAGAGCTGACACATGAAAAATGG - Intronic
1126319882 15:47410459-47410481 AACAGCTATAACATTTAAAAGGG - Intronic
1126712117 15:51470624-51470646 CAGAGTTAACACATGTAAAGAGG + Intronic
1127441329 15:59011753-59011775 TAGAGATAAGACATTTAAAGAGG - Intronic
1136935351 16:34458170-34458192 CAGAGCCAAGACAATAACAATGG - Intergenic
1136938188 16:34495811-34495833 CAGAGCCAAGACAATAACAATGG - Intergenic
1136946336 16:34655771-34655793 CAGAGCCAAGACAATAACAATGG + Intergenic
1136949184 16:34694331-34694353 CAGAGCCAAGACAATAACAATGG + Intergenic
1136961630 16:34852746-34852768 CAGAGCCAAGACAATAACAATGG + Intergenic
1136964467 16:34890400-34890422 CAGAGCCAAGACAATAACAATGG + Intergenic
1137089074 16:36165617-36165639 CAGAGCCAAGACAATAACAATGG + Intergenic
1137218429 16:46423714-46423736 CAGAGCCAAGACAATAACAATGG - Intergenic
1137974754 16:53021986-53022008 CAGACCAATGACCTTTAAAAAGG + Intergenic
1138128936 16:54462188-54462210 CAAAGCTCAGAGAATTAAAAAGG - Intergenic
1138410135 16:56832916-56832938 CAGAGCTAAGGACCTTAAAATGG - Intronic
1138567146 16:57841830-57841852 CAGAGCCAAGACCTTGAAATGGG - Intronic
1138856350 16:60697922-60697944 AAAAGGTAATACATTTAAAAGGG + Intergenic
1139149336 16:64361717-64361739 GAGAGGTAAGACATTCACAATGG + Intergenic
1139193463 16:64891573-64891595 CAGAACTAAGACATGGGAAAGGG + Intergenic
1140232976 16:73133209-73133231 TAGAGATAAGACCTTTAAAGAGG + Intronic
1141844769 16:86600366-86600388 GAGAGCTAAGAGAATTAAAGTGG + Intergenic
1141931078 16:87203299-87203321 CAGACCCAAGACATTGAGAACGG + Intronic
1148292746 17:46470195-46470217 CAAAACAAAGACATATAAAAGGG - Intergenic
1148314931 17:46687892-46687914 CAAAACAAAGACATATAAAAGGG - Intronic
1149170644 17:53806901-53806923 AAGAGCTAATACATGTAAATGGG + Intergenic
1149175611 17:53867137-53867159 CATAGCTAAGACATTTATGAGGG + Intergenic
1151518688 17:74613579-74613601 CTGAGCAAAGACCTTTGAAAAGG + Intronic
1152086723 17:78224397-78224419 TCGAGCCAAGTCATTTAAAAAGG - Exonic
1203184170 17_KI270729v1_random:96416-96438 CAGAGCCAAGACAATAACAACGG + Intergenic
1154515584 18:15161735-15161757 CAGAGCCAAGACAATAACAATGG - Intergenic
1155720340 18:29003278-29003300 CACAGCTAAGATATTGACAAAGG - Intergenic
1156571166 18:38254803-38254825 CAGAACTAGGACATTTCAAAGGG + Intergenic
1156858141 18:41806656-41806678 CAGAGCTAAGCCATTGAGATAGG + Intergenic
1156920423 18:42515716-42515738 CAGAGTTAAGTTAGTTAAAATGG + Intergenic
1158085562 18:53647432-53647454 CAGACCTAAGACATATTAACTGG + Intergenic
1158093902 18:53748357-53748379 CTGAACTAAGAAATTTGAAATGG - Intergenic
1158111027 18:53941800-53941822 CAGAGCTATGAGATGCAAAAAGG - Intergenic
1158762213 18:60403423-60403445 CAGAGGTCAAACATTCAAAACGG - Intergenic
1158816392 18:61102733-61102755 CAGATCTAAGACACATATAAAGG + Intergenic
1159206490 18:65259734-65259756 CAGAGCCATTACATTTAAACTGG + Intergenic
1163926353 19:20348008-20348030 CAGATATAAGAGATATAAAAAGG + Intergenic
1164060624 19:21670507-21670529 CAGAGCCTATACCTTTAAAATGG - Intergenic
1165394440 19:35556697-35556719 CAGAGCTGAGACATGGAGAAAGG + Intronic
1166953396 19:46445526-46445548 CAAATTTAAGACATTCAAAATGG - Intergenic
1168125666 19:54281197-54281219 TGGAGCAAAAACATTTAAAAAGG - Intergenic
925315338 2:2918576-2918598 CAGAGCTCAGACAGTCAAGAGGG + Intergenic
925364376 2:3301811-3301833 AACACCTAAGACATTTTAAATGG - Intronic
925935459 2:8754051-8754073 CAGAGCTTAAACAGTTAAATAGG + Intronic
926154668 2:10447225-10447247 AACAGCTAAGTTATTTAAAATGG + Intronic
927015657 2:18957864-18957886 CAGAGCAAAGTAATTTAATAGGG + Intergenic
927261781 2:21098847-21098869 CAGAGCTAAGTCCTTTGAAATGG - Intergenic
927680062 2:25133086-25133108 CAGAGCCAAGAAAATTAAGAGGG - Intronic
928157187 2:28887595-28887617 CACATCGAAGACATTTAGAAAGG - Intergenic
928735700 2:34286118-34286140 TATAGATCAGACATTTAAAAAGG - Intergenic
928796338 2:35025537-35025559 CTGAGCTAACACATGAAAAAGGG + Intergenic
928889675 2:36189093-36189115 CAGAGCTAGGGAATATAAAAAGG - Intergenic
929490237 2:42389685-42389707 CAAAACTAAGAAATTTAAATTGG + Intronic
930712224 2:54559681-54559703 CAGAGCTTATACATGAAAAAAGG + Intronic
931810332 2:65848608-65848630 CAGAGTTAAGATATTTATAAGGG + Intergenic
932919012 2:75888655-75888677 CAGAGTTGAGTCATTTAAAGTGG - Intergenic
933222666 2:79708479-79708501 AAGATTTAAGACATTTAAAGTGG - Intronic
933520736 2:83369104-83369126 CATACCACAGACATTTAAAACGG + Intergenic
933887388 2:86731385-86731407 CAGATTTAAGAAATTTAGAATGG - Intronic
933922787 2:87065328-87065350 CAGATTTAAGAAATTTAGAATGG + Intergenic
934332125 2:92078448-92078470 CAGAGCCAAGACAATAACAATGG + Intergenic
935314007 2:101813345-101813367 CAGAGCGAAAACACTAAAAAAGG + Intronic
935393476 2:102580160-102580182 CAAAGCTACTATATTTAAAATGG + Intergenic
935704252 2:105841966-105841988 CAGAGATCAGAAATGTAAAATGG + Intronic
936242896 2:110803395-110803417 CAGAGCCAAGACAATTCAATGGG + Intronic
936388070 2:112048107-112048129 CAGAGATAAGGCCTTTAAAGAGG - Intergenic
936780246 2:116023896-116023918 CAGAGCCAAGAGATTGAAATGGG - Intergenic
937825135 2:126360592-126360614 CAGAGCTTAGGCACTTAAGAGGG + Intergenic
938515847 2:132006524-132006546 CAGAGCCAAGACAATAACAACGG - Intergenic
939119031 2:138093724-138093746 AAGATATAAGAAATTTAAAAAGG + Intergenic
940280808 2:151987812-151987834 CAAAGGGAAGACATTTAAATTGG - Intronic
940641193 2:156345893-156345915 CAGAGCTAAGAAACCAAAAAAGG - Intergenic
941780823 2:169442600-169442622 CAGAGCAAAGACAATTACCAGGG + Intergenic
942007505 2:171719963-171719985 AAGAGTTAAAACTTTTAAAAAGG - Intronic
942148654 2:173052258-173052280 CAGAGGTAAGACAATGAAGATGG - Exonic
943993611 2:194731604-194731626 TAGAGTTAAAATATTTAAAAAGG + Intergenic
944231634 2:197400050-197400072 CATACCTATGACATTTACAATGG + Exonic
945243712 2:207699245-207699267 CAGAGGTAATACAGTTAAAATGG - Intergenic
945320398 2:208415267-208415289 AAGATTTAAAACATTTAAAAGGG + Intronic
945636478 2:212359144-212359166 CTGAGTCAAGACATTTTAAAGGG - Intronic
945793449 2:214333150-214333172 CAGATCTATGATATTTTAAAAGG - Intronic
947903321 2:233740817-233740839 TTGAGCTGAGACATTTTAAAAGG + Intronic
1169598144 20:7224723-7224745 CAGATCTAAGACTTTTTTAATGG + Intergenic
1173343361 20:42175210-42175232 CAGATTTAAGATATTTAATATGG + Intronic
1174303405 20:49598547-49598569 CATAGGTAAGACATTTAAATGGG - Intergenic
1174345620 20:49927316-49927338 CAGAGGTAAAACATACAAAATGG + Intergenic
1174851233 20:53997121-53997143 CACAGCAAAGATTTTTAAAAGGG - Intronic
1175191019 20:57212244-57212266 CAGAACTAACACAGCTAAAAGGG + Intronic
1176777943 21:13156417-13156439 CAGAGCCAAGACAATAACAATGG + Intergenic
1176989188 21:15473946-15473968 CAGGTCTACAACATTTAAAATGG - Intergenic
1177661720 21:24092911-24092933 TAGACGTAATACATTTAAAATGG - Intergenic
1178316299 21:31569433-31569455 CAGAGATAAGCCTTTTAAAGAGG - Intergenic
1180254231 21:46612344-46612366 CAGAGCAAAGAAAATTATAATGG - Intergenic
1180525721 22:16257841-16257863 CAGAGCCAAGACAATAACAATGG + Intergenic
1203322649 22_KI270737v1_random:83071-83093 CAGAGCCAAGACAATAACAATGG - Intergenic
949833325 3:8240653-8240675 CAGAATTAAGACAATTAGAATGG - Intergenic
950766610 3:15277733-15277755 AAGTACTAAGACATTTAGAAAGG - Intronic
951070505 3:18322908-18322930 CACAGCTAAGACTGTTAAGAGGG + Intronic
951078057 3:18421054-18421076 TAGAGCTAAAACATTTACATAGG - Intronic
951531015 3:23698149-23698171 CAGAGCTGAGGTCTTTAAAAGGG + Intergenic
952006623 3:28848747-28848769 GAGAGCTAGGACATTTATAGAGG + Intergenic
952144200 3:30514044-30514066 CAATGCTAAGACATTAAACAAGG + Intergenic
952283841 3:31948732-31948754 CATAGCTAAGAAATTGGAAAAGG + Intronic
952660580 3:35841741-35841763 CAGAGTTAACACATTTAGAAAGG + Intergenic
953507814 3:43503552-43503574 CAGAGCTAAGCCATATGACAAGG + Intronic
956067989 3:65417379-65417401 CATAGCAAAGACTTTTCAAATGG + Intronic
956734515 3:72227966-72227988 CTGAACAAAGACATATAAAAGGG + Intergenic
957274941 3:78079093-78079115 CTGATCTAAGTCATTTAAATGGG - Intergenic
957648221 3:82963268-82963290 CAGAGTTAAGAAATGTAGAAAGG - Intergenic
958093415 3:88907128-88907150 CAGATCTAAGACATCTAGAGGGG - Intergenic
961933242 3:130555399-130555421 CAGAGCAAAGGCATTGAGAATGG - Intergenic
962062031 3:131938805-131938827 CAGAGCCAAACCATATAAAATGG + Intronic
962126110 3:132620216-132620238 CAGAGCTAAGACCTATATAAAGG - Intronic
962146813 3:132848275-132848297 CACAGCCAACTCATTTAAAAAGG - Intergenic
962499308 3:135973727-135973749 CAGAACTAAGACTGTTTAAATGG + Intronic
962655401 3:137539364-137539386 CATAGCCAAGGCAGTTAAAAGGG - Intergenic
963329407 3:143897294-143897316 CATAAGTAAGACATTAAAAAAGG - Intergenic
963470026 3:145728758-145728780 TAGAGATAGGACATTTCAAAAGG - Intergenic
964406300 3:156352482-156352504 CAGAGCTCACACAGTTGAAAAGG + Intronic
964632663 3:158829546-158829568 CAGAAATAAGAAATTGAAAAGGG - Exonic
964828032 3:160851049-160851071 CAGAGGGAAGAAAATTAAAAAGG - Intronic
965683333 3:171274761-171274783 TTGAGTTAAGAAATTTAAAATGG + Intronic
966166756 3:177028077-177028099 CAGAGCTAAGACATTTAAAAAGG + Intronic
967313025 3:188124222-188124244 CAGAGCTAAGACATTTTCAAAGG - Intergenic
967837891 3:193979942-193979964 AAGAACTAAGACACTTTAAAGGG + Intergenic
968147425 3:196311122-196311144 CAGAACTAATAAATTCAAAATGG + Intronic
968745788 4:2359426-2359448 CAGAGATAGGATATTTAAAGAGG + Intronic
969405777 4:6990710-6990732 AAGAGATAAGATATGTAAAATGG - Intronic
969969712 4:11033076-11033098 CAAAGAGAAGACATTTAGAATGG + Intergenic
971528126 4:27648477-27648499 TAGAGATAAGACCTTTAAAGAGG - Intergenic
973169000 4:47115193-47115215 GATAGCTAATACATCTAAAATGG + Intronic
974355170 4:60803400-60803422 CAGAGCTTAAATATGTAAAAAGG + Intergenic
974650620 4:64749101-64749123 CAGAGCGAAGGCATTGAGAATGG - Intergenic
974718544 4:65704557-65704579 CACAGCAAAGACAGTAAAAATGG - Intergenic
976447367 4:85146673-85146695 CAGACAAATGACATTTAAAATGG + Intergenic
976475387 4:85476841-85476863 AAGAATTAAGAAATTTAAAAGGG - Intronic
977393000 4:96437219-96437241 GACTGCTAAGAAATTTAAAAGGG - Intergenic
977711981 4:100137106-100137128 CAGAGCCAAGACATATCAGATGG - Intergenic
978268858 4:106863271-106863293 CATAGAGAACACATTTAAAATGG + Intergenic
978432555 4:108648799-108648821 TAGATTTAAGACGTTTAAAATGG - Intergenic
979857858 4:125656763-125656785 TAGAGCAAATACATTTAAATTGG - Intergenic
980475803 4:133314386-133314408 CAAAATGAAGACATTTAAAATGG + Intergenic
980480487 4:133380585-133380607 CAAAGATAAGACTTTGAAAAAGG - Intergenic
980577395 4:134702082-134702104 CACATGTAAGCCATTTAAAAAGG - Intergenic
981402491 4:144329812-144329834 AAGAGCTAATACATTTAATCTGG + Intergenic
981412043 4:144443108-144443130 CAAAGATAACATATTTAAAAGGG - Intergenic
982148783 4:152428647-152428669 CATAGGTAAAACATTTAACAAGG + Intronic
982787769 4:159556364-159556386 AATAGCCAAGAAATTTAAAAAGG + Intergenic
984812639 4:183808093-183808115 CAGAGAACAGAGATTTAAAAAGG - Intergenic
984848803 4:184133556-184133578 CAGGGATAAAACAATTAAAAAGG - Intronic
985354194 4:189099747-189099769 GAGAGCTAAGACAGCTAAGATGG - Intergenic
987244628 5:16036531-16036553 GAGAGCTATGACAATTAATATGG - Intergenic
987560937 5:19519171-19519193 TAGACATAATACATTTAAAAGGG - Intronic
987866061 5:23540813-23540835 CTGACCTAAGACATTTGGAAAGG - Intergenic
989976328 5:50591464-50591486 AAAAGAAAAGACATTTAAAAAGG + Intergenic
990546396 5:56826035-56826057 CATAGATAAGGCATTTGAAATGG + Intronic
992227299 5:74631486-74631508 TAGTGCTAAAACATTTAAGAGGG - Intronic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
994708424 5:103234415-103234437 CAGAGCCAAGAAAGTTACAAGGG - Intergenic
995114547 5:108464940-108464962 TAGAACTAAGTTATTTAAAATGG + Intergenic
996513933 5:124348985-124349007 CAAAGCTTAGAAATTTGAAATGG + Intergenic
996646645 5:125825930-125825952 CAGTGCTATGTCATTTAAAAAGG - Intergenic
996890176 5:128409607-128409629 AATTGCTAATACATTTAAAAAGG + Intronic
997167559 5:131677049-131677071 AAGAGATAATACATGTAAAATGG - Intronic
997664200 5:135615578-135615600 CAGAACTTACATATTTAAAAGGG + Intergenic
998496482 5:142594754-142594776 CAGAACAGAGGCATTTAAAATGG - Exonic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999552234 5:152701918-152701940 CAGACCTAAGACAGTAAAGAAGG + Intergenic
1000845193 5:166270881-166270903 AACAGATAAGCCATTTAAAAGGG + Intergenic
1002574871 5:180168775-180168797 GAGAGCAAAGATTTTTAAAATGG + Intronic
1003285327 6:4729054-4729076 CAGAGAGAAGACATTAAATAAGG - Intronic
1003845286 6:10167374-10167396 CTGAGCTAAGAGACTAAAAATGG - Intronic
1005175784 6:23042968-23042990 CCTAGCTAAGACATTTAAAGAGG - Intergenic
1005681331 6:28211701-28211723 CAGAGATAGGACATTTCACAGGG + Intergenic
1007506404 6:42338415-42338437 CAGAGGTATGAAATTCAAAATGG + Intronic
1007735575 6:43980327-43980349 TGGAGCTAAGACATTGAACAGGG - Intergenic
1008135102 6:47766231-47766253 CAGAGCAAAGAAATTTGCAAGGG - Intergenic
1009586461 6:65611995-65612017 CATATATAAGCCATTTAAAATGG + Intronic
1010163259 6:72884325-72884347 CAGAGCCAAAACCTTTTAAAGGG + Intronic
1010873365 6:81069750-81069772 CAGAGCAAATATATTTAACATGG + Intergenic
1011808529 6:91101238-91101260 CATAGCTAATACACTTCAAAAGG + Intergenic
1012777568 6:103517035-103517057 CGGAGATAAGGCCTTTAAAAAGG + Intergenic
1013006233 6:106076582-106076604 CAGATCTAATAAATTTAAACTGG - Intergenic
1015861134 6:137681398-137681420 CAGAGCTAAGAAATTCAAGGTGG - Intergenic
1016544633 6:145207288-145207310 CAGACGTAACCCATTTAAAATGG - Intergenic
1017209594 6:151840445-151840467 CAGAACTAAGTTATTTAGAATGG + Intronic
1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG + Intronic
1018781226 6:167067597-167067619 CAGAGCAAAGACAATTACCAGGG + Intergenic
1020046619 7:5045684-5045706 CAGGGTAGAGACATTTAAAACGG + Intronic
1020969842 7:14922222-14922244 CAGAGCAACGACATTTACAAAGG + Intronic
1021195609 7:17671088-17671110 CAGAGCTGAGACTTCAAAAATGG + Intergenic
1021438229 7:20646501-20646523 CAGAGAGAAGACATTTAGCAAGG - Intronic
1022514663 7:30967865-30967887 CAAAGGTCAGAAATTTAAAATGG + Intronic
1022607645 7:31831994-31832016 CACAGGAAAGACATTGAAAAGGG + Intronic
1022886230 7:34647930-34647952 TAGAAGTAAGTCATTTAAAAAGG + Intergenic
1023493007 7:40764223-40764245 CTGAGGTAAGGCATTTAACAGGG - Intronic
1023777285 7:43619933-43619955 CAGAGCTAAGAGAATTTGAAGGG + Intronic
1025146922 7:56513218-56513240 CAGAGCTGGGATATTTAAATCGG - Intergenic
1025475047 7:60908746-60908768 CAGAGCCAAGACAATAACAATGG + Intergenic
1025487851 7:61074241-61074263 CAGAGCCAAGACAATAACAATGG - Intergenic
1025511953 7:61581124-61581146 CAGAGCCAAGACAATAACAATGG - Intergenic
1025556510 7:62316159-62316181 CAGAGCCAAGACAATAACAATGG - Intergenic
1025563418 7:62400113-62400135 CAGAGCCAAGACAATAACAATGG + Intergenic
1025566133 7:62436230-62436252 CAGAGCCAAGACAATAACAATGG + Intergenic
1026102117 7:67392018-67392040 CTGAGATAAGAAATTTAAAGGGG + Intergenic
1026336546 7:69398709-69398731 CTAAGCTAAGCCATTTAAAAGGG - Intergenic
1027667721 7:81059280-81059302 CAGTGGTAAGAAAATTAAAATGG + Intergenic
1028105195 7:86868505-86868527 CATAGCTAAGAGGTTTAGAATGG - Intergenic
1028154138 7:87410317-87410339 TAAAGCTAAGATATTAAAAATGG + Intronic
1029221924 7:98996956-98996978 CACACCTAAAACAGTTAAAAAGG + Intronic
1029874053 7:103729773-103729795 TAGACCTCAGACCTTTAAAATGG - Intronic
1031107134 7:117557993-117558015 CAGAGCTATGCCCTTAAAAATGG - Intronic
1031346991 7:120680002-120680024 CATAGATAAGAGAATTAAAAGGG + Intronic
1032690780 7:134284426-134284448 TAGATTTAACACATTTAAAATGG + Intergenic
1032701465 7:134383618-134383640 CAGTGCTAAGCCATTTACAAGGG - Intergenic
1032945222 7:136844073-136844095 TAGAGCAAATACATTAAAAATGG + Intergenic
1033030680 7:137823105-137823127 TAGAGCGAAGAGATCTAAAAAGG + Intronic
1037027412 8:14056236-14056258 CAGTTCTAAGACATTTATAAAGG + Intergenic
1037654812 8:20873768-20873790 AATAGCTAAGACAGTCAAAAAGG - Intergenic
1037697553 8:21238611-21238633 CACAGTTAAGACCATTAAAAAGG - Intergenic
1039057359 8:33547600-33547622 AAAAGTAAAGACATTTAAAAAGG + Intergenic
1040869530 8:52086681-52086703 CAGAGCCAAGACATTAACAAAGG + Intergenic
1041083961 8:54240166-54240188 AAGAGCTGTGAGATTTAAAAGGG + Intergenic
1041878891 8:62723708-62723730 AACACCTAAGACATTTAATAAGG - Intronic
1041954988 8:63548442-63548464 CAGGGCAAAGATATTTCAAATGG + Intergenic
1043127458 8:76417878-76417900 CAGAGCTAAACCATATTAAATGG - Intergenic
1043692319 8:83169496-83169518 TAGAGATAAGACATTTAAAGAGG + Intergenic
1044139023 8:88625218-88625240 CAAAGCTAAGAAATTGAAATTGG + Intergenic
1045110126 8:98932550-98932572 CAGAGGAAAGTGATTTAAAAGGG + Intronic
1045636108 8:104192527-104192549 ATTAGCTAATACATTTAAAATGG - Intronic
1045769354 8:105717027-105717049 AAGTGCTGATACATTTAAAAGGG + Intronic
1045964358 8:108007018-108007040 CAGATCTCAGACATTTAACATGG + Intronic
1046216054 8:111148835-111148857 CAAAGGGAAGGCATTTAAAAAGG - Intergenic
1046430815 8:114125444-114125466 TAGAGATAAAACATTTTAAAAGG + Intergenic
1046853178 8:118999103-118999125 TATAGCTAAGACTATTAAAAAGG + Intronic
1047878268 8:129164777-129164799 CATAGCTAGGACATTGAGAATGG + Intergenic
1048686502 8:136910641-136910663 CAGAACCTATACATTTAAAATGG - Intergenic
1048743556 8:137588721-137588743 CAGAAAAAAGACATTTCAAAAGG - Intergenic
1050616946 9:7411046-7411068 CACATCTACGACATATAAAAGGG - Intergenic
1051512356 9:17892319-17892341 CACAGCTATGACATTCTAAAAGG - Intergenic
1051616189 9:19009268-19009290 CAGAGCTAAGAAAGGTAAAAAGG + Intronic
1051739604 9:20238688-20238710 CAAAGCTAAGACATGTACACTGG - Intergenic
1051834309 9:21317838-21317860 GAGAGCAAAGACATTTGTAAAGG - Intergenic
1051979058 9:22991108-22991130 AAGAGCTATGCTATTTAAAATGG - Intergenic
1052240243 9:26263189-26263211 CAGAATTAAAATATTTAAAAAGG + Intergenic
1052404994 9:28048150-28048172 AAGGGGTAAGACATTTAATAAGG + Intronic
1053069207 9:35091222-35091244 CAGAGCTGAGATATTTACCAGGG + Exonic
1053101737 9:35377093-35377115 GACAGCTATGACATATAAAAGGG + Intronic
1053614812 9:39753313-39753335 TAGATCTAACACATTTAGAACGG + Intergenic
1053872839 9:42511247-42511269 TAGATCTAACACATTTAGAACGG + Intergenic
1053899918 9:42784667-42784689 TAGATCTAACACATTTAGAACGG - Intergenic
1053946636 9:43315869-43315891 CAGAGCCAAGACAATAACAATGG + Intergenic
1054238705 9:62589077-62589099 TAGATCTAACACATTTAGAACGG - Intergenic
1054261727 9:62872923-62872945 TAGATCTAACACATTTAGAACGG + Intergenic
1054269491 9:62955505-62955527 TAGATCTAACACATTTAGAACGG - Intergenic
1054552836 9:66623599-66623621 TAGATCTAACACATTTAGAACGG - Intergenic
1056255418 9:84794647-84794669 CAGAGGAAAGACAATAAAAAGGG - Intronic
1057973674 9:99581212-99581234 AAGAGCTCAGACATTTAATGTGG - Intergenic
1058553777 9:106144051-106144073 AAGAACGAAGACATTAAAAAAGG - Intergenic
1059007903 9:110423488-110423510 TAGTGATAAGACATTTAAGATGG + Intronic
1059748230 9:117223446-117223468 CAGAACTAAGAGAGTTAAAGTGG + Intronic
1203589766 Un_KI270747v1:44427-44449 CAGAGCCAAGACAATAACAATGG + Intergenic
1185516872 X:706694-706716 GAGAGCTTAGACATTAAAAGTGG + Intergenic
1185949370 X:4414355-4414377 AAGAGCTGATATATTTAAAAGGG - Intergenic
1187143063 X:16613095-16613117 CAGAGAAAAGGCATTTGAAATGG + Intronic
1187653962 X:21448211-21448233 CAGAGCCTATACATTTATAAAGG + Intronic
1187818750 X:23262296-23262318 CAGAGCAAACACTTTTAAAATGG + Intergenic
1189012164 X:37056662-37056684 CAGAAATAAAACATATAAAAGGG - Intergenic
1189036547 X:37499621-37499643 CAGAAATAAAACATATAAAAGGG + Intronic
1190019954 X:46865113-46865135 CAAAGCTAAGAAATTTACATTGG + Intronic
1190447475 X:50542504-50542526 CAGAGCAAGGACATTTATCAAGG + Intergenic
1190755869 X:53401405-53401427 TAGAACTAAGACATTTTACAAGG - Intronic
1191210959 X:57884638-57884660 AAGAACTAAGACATTCATAAGGG + Intergenic
1191978401 X:66899232-66899254 GAAAGCTAAGACTTTTAAAGGGG + Intergenic
1192052507 X:67738571-67738593 GAGAGTTAACATATTTAAAATGG - Intergenic
1192280965 X:69684999-69685021 CAAAACAAAGACATTTAAAATGG - Intronic
1192596945 X:72420409-72420431 CAGAGATAAAAATTTTAAAAAGG - Intronic
1192736689 X:73855921-73855943 CAGGGCTATGCCATTTAAAGAGG + Intergenic
1193804477 X:85977689-85977711 CAGTGCTGAAAGATTTAAAACGG - Intronic
1193945631 X:87729606-87729628 CAGAACTAAGACATTCATGAGGG + Intergenic
1194966241 X:100291694-100291716 CAGAGAAAACACATTTAAAGGGG + Exonic
1195017254 X:100791731-100791753 CTGAGCTAGGACATTTCACAAGG + Intergenic
1195460727 X:105120814-105120836 CTGATCTAATTCATTTAAAAAGG - Intronic
1195529461 X:105935985-105936007 CAGAGTTAAGACATTATAGAAGG - Intronic
1196259244 X:113558690-113558712 CAGAGATAGCACATTGAAAATGG - Intergenic
1198026663 X:132713948-132713970 CAGTCCTATGACATTTAAACAGG + Intronic
1200002474 X:153069150-153069172 CAGAGCTAAGATGTTCAAACCGG - Intergenic
1200005250 X:153080860-153080882 CAGAGCTAAGATGTTCAAACCGG + Intergenic
1200179087 X:154139528-154139550 CTGAGCTAAGACTCTTTAAAAGG + Intergenic
1201267306 Y:12220321-12220343 CAGAGAGAAGACATTTATACAGG - Intergenic