ID: 966167823

View in Genome Browser
Species Human (GRCh38)
Location 3:177041040-177041062
Sequence TTGACTATGTTTACTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966167823_966167827 17 Left 966167823 3:177041040-177041062 CCCAACAAAGTAAACATAGTCAA 0: 1
1: 0
2: 1
3: 33
4: 342
Right 966167827 3:177041080-177041102 TGTCAGGCTGAGTAAGTTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 120
966167823_966167825 1 Left 966167823 3:177041040-177041062 CCCAACAAAGTAAACATAGTCAA 0: 1
1: 0
2: 1
3: 33
4: 342
Right 966167825 3:177041064-177041086 AATCACACCTCAGAGTTGTCAGG 0: 1
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966167823 Original CRISPR TTGACTATGTTTACTTTGTT GGG (reversed) Intronic
903085095 1:20849547-20849569 TTTATTATTTTTACTTTTTTTGG - Intronic
903089869 1:20903787-20903809 TTGAGTGTGTTTACTTCATTCGG - Intronic
903308915 1:22437114-22437136 TTGTTGATGTTTAGTTTGTTTGG - Intergenic
904921504 1:34011775-34011797 TTGACTATAGTTACCCTGTTGGG + Intronic
905256987 1:36691185-36691207 TTGAATATGTTGAGTTTGCTTGG - Intergenic
906137903 1:43513137-43513159 TAGTCTAGCTTTACTTTGTTTGG - Intergenic
906349034 1:45041126-45041148 TTGCTTATGTTTCCTTTGTCAGG - Intronic
908946999 1:69510583-69510605 TTTCCTATGCTTACTTAGTTAGG - Intergenic
908999219 1:70198085-70198107 TTCAATATGTATAGTTTGTTGGG - Intronic
909061243 1:70881719-70881741 ATGACTGTGTTTCTTTTGTTGGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909544827 1:76834480-76834502 TTGACTAATTGTACTTTGATTGG - Intergenic
909766563 1:79363469-79363491 TTCTTTATGTTTTCTTTGTTTGG - Intergenic
910729292 1:90374977-90374999 TTTTCTCTGTTTACCTTGTTTGG + Intergenic
911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG + Intergenic
911780596 1:101871311-101871333 TAGACTGTGTTTTCTCTGTTGGG - Intronic
911871131 1:103100724-103100746 TTGTCCATGTTGACTTTGCTGGG - Intronic
911941215 1:104050030-104050052 TTGAATGTGTCTACTTTGTGTGG - Intergenic
912559518 1:110539887-110539909 GTCACTCTCTTTACTTTGTTAGG + Intergenic
913395545 1:118367173-118367195 TTAACTCTGTTTGTTTTGTTTGG + Intergenic
913420593 1:118663713-118663735 TTGACTATGTTGTTTTTGTTAGG - Intergenic
914875471 1:151510363-151510385 TTGACTTCGTTTACGTTGCTGGG - Intergenic
916041444 1:160964984-160965006 TTGAATTTGTTTATATTGTTTGG - Intergenic
916293283 1:163189356-163189378 TTGAACATTTTTACCTTGTTGGG - Intronic
916304774 1:163318112-163318134 TGGACTATCTTTATTTTCTTTGG - Intronic
916380320 1:164202750-164202772 TTGACTATATTTTAATTGTTTGG - Intergenic
918264066 1:182823533-182823555 TTGTCGATGTTTAGTTTATTTGG - Intronic
918643301 1:186871126-186871148 TTGAGTGTGTTTATTTTGTATGG + Intronic
918775100 1:188618254-188618276 TCTACTTTGTTGACTTTGTTGGG - Intergenic
919402018 1:197130677-197130699 TTAACTTTATTTACTTTTTTTGG + Intronic
919616854 1:199818721-199818743 TGGATTTTGTTTTCTTTGTTTGG - Intergenic
920016009 1:202909402-202909424 TTAACTATTTTTACATAGTTTGG + Intronic
920550198 1:206854176-206854198 TTGACTATAGTCACCTTGTTGGG - Intergenic
921457780 1:215393108-215393130 TTGTCTATTTTTACTTTTGTTGG - Intergenic
921751015 1:218794430-218794452 TTTACTATGGTAACTTCGTTAGG - Intergenic
922177593 1:223208715-223208737 TTAATTATTTTTACTTTTTTAGG - Intergenic
922412838 1:225392416-225392438 CTGACTATGTTGAGTTTCTTTGG - Intronic
923514894 1:234688394-234688416 TTGTCTATTTTTACATTGTGTGG - Intergenic
923682007 1:236125996-236126018 TTTACCATGTTCACTTTGTGGGG - Intergenic
924083290 1:240421599-240421621 TTGACTATATTTGTTTTGTGGGG + Intronic
1066091447 10:32025274-32025296 ATGACTATGTTAGCTTTGTAAGG - Intronic
1066551027 10:36557321-36557343 GTGTCTATGTTTAATTTTTTTGG - Intergenic
1067421201 10:46150522-46150544 TTGACTCTGTTTAATTTGTCTGG + Intergenic
1067491051 10:46703181-46703203 TTGACTCTGTTTAATTTGTCTGG + Intergenic
1067506538 10:46856981-46857003 TTGACTCTGTTTAATTTGTCTGG + Intergenic
1067603614 10:47637185-47637207 TTGACTCTGTTTAATTTGTCTGG - Intergenic
1067677314 10:48393403-48393425 TTGACTATGGTTACAATGTAAGG - Intronic
1068405223 10:56579492-56579514 TTAACTATGTTTACCTTGTATGG - Intergenic
1069262624 10:66417269-66417291 TTGTCTTTGTTTACTGTTTTTGG - Intronic
1069350729 10:67523707-67523729 TTGGCTGTGTTTAATATGTTGGG - Intronic
1070372360 10:75794617-75794639 TTGACTATATTTATTCTATTAGG + Intronic
1070601414 10:77868890-77868912 TTGCCATTGTTTACTTTGTCAGG - Intronic
1071145555 10:82566289-82566311 TTGACTGTTCTTACTTTTTTGGG + Intronic
1072375285 10:94809451-94809473 TTGTCCATTTTTACTTTGGTTGG + Intronic
1072447257 10:95510145-95510167 ATGACTATTTTTTCTTTTTTTGG - Intronic
1073880719 10:107976424-107976446 TTGACTCTTTTTAATTTGTGTGG + Intergenic
1074793668 10:116919091-116919113 TTCACTGTGTTTTCTTTCTTAGG - Intronic
1077822243 11:5758335-5758357 TTGGCTATGATTTCTTAGTTAGG + Intronic
1077996407 11:7456200-7456222 TTGACTATTTTTAGTTGATTTGG + Intronic
1078221462 11:9354900-9354922 TTGACTTTGTTTTTTTTTTTTGG - Intergenic
1078585154 11:12579043-12579065 TTGATAATTTTTATTTTGTTAGG - Intergenic
1079751662 11:24207227-24207249 TTGACTATGGTCACCCTGTTGGG - Intergenic
1080989052 11:37507962-37507984 TTGCATATATTTACTTTGTAGGG - Intergenic
1081133520 11:39409302-39409324 TTGACAATTTTTGCTTTGGTTGG - Intergenic
1081161161 11:39750720-39750742 CTGAGTATGTTTATTTTATTTGG + Intergenic
1081193695 11:40135615-40135637 TTAACTATGTTTCCTTGATTTGG + Intronic
1083411973 11:62500128-62500150 TAGACTATGTTTAATCTCTTGGG - Intronic
1083533269 11:63444893-63444915 TTGACTATAGTCACTCTGTTGGG + Intergenic
1086021928 11:82240271-82240293 TTGGCTCTGTTCACTCTGTTTGG + Intergenic
1086249150 11:84794209-84794231 TTGACTATATTCACCTTGCTGGG - Intronic
1086551002 11:88051531-88051553 TTGACTTTTTTTTTTTTGTTAGG - Intergenic
1087720283 11:101656692-101656714 TTTTCTATGTTTACCTTCTTTGG + Intronic
1087801442 11:102509095-102509117 TTCACTGTGGTTACTTTGTGGGG + Intergenic
1087979530 11:104593791-104593813 TTTTCTATGTTTTCTTTCTTTGG + Intergenic
1088037997 11:105341542-105341564 CTGACTAAGGTTTCTTTGTTAGG - Intergenic
1088415406 11:109583182-109583204 TTGACTATGATTATTTCCTTAGG + Intergenic
1089334481 11:117713655-117713677 TTCATTATGTTTGTTTTGTTTGG - Intronic
1090306092 11:125692569-125692591 TTGGTTATGTTAACTTTTTTTGG - Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1092498175 12:9018956-9018978 TTCACTTTGTTTCCTTTGCTGGG - Intergenic
1092666898 12:10810953-10810975 TTGACTATTTTTTCTATGTATGG - Intergenic
1092691591 12:11117421-11117443 TGGACTATCTTTTCTTTTTTTGG - Intronic
1093201660 12:16194420-16194442 TTGCCTTTGTTTAATGTGTTTGG + Exonic
1093693099 12:22129326-22129348 TTGATTGTGTTTACTTTCTTTGG + Intronic
1094750395 12:33399503-33399525 TTGACTACTTTTACTTTCATGGG - Intronic
1095278545 12:40321441-40321463 TTGACTGTGATTACATTGTAGGG + Intronic
1097311676 12:58125790-58125812 TTGGCTATGTGGACTTTTTTTGG + Intergenic
1097738622 12:63212038-63212060 TTGACTATGTCCACTATGATAGG + Intergenic
1098078198 12:66756096-66756118 TTAAGTATATTTACATTGTTGGG + Intronic
1098948517 12:76614976-76614998 TTGAGAATTTTTACTTGGTTTGG - Intergenic
1099612921 12:84897816-84897838 TTTACTTTGTTTTCTCTGTTTGG - Intronic
1099702423 12:86103996-86104018 ATGTCTATGTTTACTTTTTGAGG - Intronic
1099949100 12:89280337-89280359 TTCACTGAGTTTATTTTGTTGGG - Intergenic
1103262574 12:119600993-119601015 TTGACTATTTTTATCTTTTTTGG - Intronic
1105596516 13:21844290-21844312 TTAAATATTTTTACTATGTTTGG + Intergenic
1105713813 13:23040768-23040790 TTGCCTATTTTTACTTTTGTTGG + Intergenic
1109361142 13:61296460-61296482 ATGAGTCTGTTTACCTTGTTAGG + Intergenic
1109784686 13:67158200-67158222 ATGCATATGTTTACTTTCTTTGG - Intronic
1111893461 13:94112026-94112048 TTTACGATGTTTACTTTTCTTGG - Intronic
1114915194 14:27255060-27255082 TTTAATATGTTGATTTTGTTGGG + Intergenic
1115056381 14:29132773-29132795 TTGTCTTTGTTTACCTTGTGTGG + Intergenic
1115088955 14:29550901-29550923 TTGACTGAGCTTTCTTTGTTGGG - Intergenic
1115404993 14:33005403-33005425 GTGAATCTGTATACTTTGTTGGG + Intronic
1115462248 14:33674411-33674433 TTGATGATGGTTATTTTGTTTGG - Intronic
1116076856 14:40121666-40121688 CTGACCATGTTTAATTTATTGGG - Intergenic
1116363860 14:44036568-44036590 TTGACTATTTTTAGTTTGATGGG - Intergenic
1117947406 14:61043125-61043147 CTGATTCTGTTTACTTTTTTAGG + Exonic
1118943171 14:70357545-70357567 TGGACTATGTTTCCTTTTATTGG - Intronic
1120351386 14:83363993-83364015 TTGATTATATTTTCTCTGTTAGG - Intergenic
1120627232 14:86843322-86843344 TTCACTGTGTTTACCTTGTTTGG + Intergenic
1120904129 14:89604688-89604710 TTGTATGTGTTTATTTTGTTTGG - Intronic
1121703279 14:95972988-95973010 ATGTCTTAGTTTACTTTGTTGGG + Intergenic
1126054894 15:44720772-44720794 TTGACTTTGGTTAATTTGCTAGG + Intergenic
1126287291 15:47027571-47027593 ATGCCTGTGTTTCCTTTGTTAGG - Intergenic
1126492225 15:49250056-49250078 ATGACTCTGTCTCCTTTGTTTGG + Intronic
1131549049 15:93340794-93340816 TTGGCTTCGCTTACTTTGTTGGG - Intergenic
1131760230 15:95614759-95614781 ATGAAGATTTTTACTTTGTTTGG - Intergenic
1135151315 16:20008908-20008930 TTGACTATAGTCACTTTGTTGGG + Intergenic
1138913595 16:61433952-61433974 TTGTCTATGATTATTTTGTTAGG - Intergenic
1139160113 16:64494825-64494847 AGGCCTACGTTTACTTTGTTTGG - Intergenic
1139717909 16:68828429-68828451 ATGACAATGTCTACTTTCTTGGG - Intronic
1140282819 16:73570201-73570223 CTGAATATGTTAACTTTTTTTGG - Intergenic
1140447150 16:75039252-75039274 TTTATTATTTTTAATTTGTTTGG + Intronic
1141587474 16:85044403-85044425 TTGACAATGTTTCCTTTCTTGGG + Intronic
1143225820 17:5302059-5302081 TTGACTAAGTTTAGTTTGAAGGG + Intronic
1143387720 17:6541946-6541968 TTCAGTATGTCTACTTTGCTAGG - Intronic
1144372194 17:14602447-14602469 TTGGCTATGTGGACTTTTTTTGG - Intergenic
1148429739 17:47632799-47632821 CTGAATATTTTTACTTTTTTTGG - Intergenic
1149065855 17:52478483-52478505 TGGCCTATGTTTACTTTGGGTGG - Intergenic
1149133050 17:53330996-53331018 TTGACTATCTTTGATGTGTTTGG - Intergenic
1149137393 17:53384861-53384883 TTGACTATGTATAATGTGTCAGG - Intergenic
1149240481 17:54643046-54643068 TGGACTATGTTTACTGATTTGGG - Intergenic
1150960827 17:69910564-69910586 ATGACTATGATTACTATGATTGG - Intergenic
1153426008 18:4964631-4964653 TTCACTATTTTTACTTAGTTTGG - Intergenic
1153444815 18:5159079-5159101 TTGGCTCTTTTTACTGTGTTGGG + Intronic
1155370428 18:25094248-25094270 TTGACTATGAGTATTTTGTTTGG + Intronic
1155741103 18:29288902-29288924 TTGTCTATGTTTGCTTTTCTTGG - Intergenic
1156296914 18:35800941-35800963 TTGATTATGTATATTTTCTTGGG - Intergenic
1157045067 18:44092678-44092700 TTTAATATTTTTACTTTGATAGG - Intergenic
1158561503 18:58517477-58517499 TTGACTTTTGTTACTTTGCTTGG - Intronic
1158711435 18:59841441-59841463 TTGTGTATGTTTTCTTTTTTGGG - Intergenic
1158850443 18:61491366-61491388 TTTCCTGTGTTTACTTTATTGGG + Intronic
1159669162 18:71201460-71201482 TTTACTATGTTTTATTTCTTTGG + Intergenic
1159855191 18:73578625-73578647 TTGTCTATGTTCACTTTTATAGG - Intergenic
1160073858 18:75653039-75653061 TTGAATATGTCTTCTTTATTGGG + Intergenic
1160440840 18:78891136-78891158 TAGAGTATGTTCACTTTATTTGG - Intergenic
1162240870 19:9353224-9353246 TTGAAAATGTTTACTTTTTATGG + Intronic
1163534521 19:17869489-17869511 TTGCATATGTTTACATTGGTCGG + Intergenic
1163574840 19:18104606-18104628 ACGACTATTTTTACTTTGGTGGG - Intronic
1165290107 19:34876482-34876504 TTTGCTATGTTTATTTTCTTAGG - Intergenic
1167667222 19:50829825-50829847 TTGACTTTTTTTTGTTTGTTTGG - Intronic
926704535 2:15827293-15827315 ATGACTCTGTTTACCTTGGTGGG - Intergenic
927930834 2:27042690-27042712 GTGACTATATTTACCTTGCTGGG + Intronic
928584607 2:32746185-32746207 TTAAATATGTTTTTTTTGTTTGG + Intronic
928849303 2:35723899-35723921 TTAGCTATTTTAACTTTGTTAGG + Intergenic
929310377 2:40417380-40417402 TTGATTATGTTTTTCTTGTTTGG - Intronic
929761219 2:44808722-44808744 TTCAGTATGTTTGCTTTGATGGG + Intergenic
930858987 2:56050232-56050254 TTGCCTAGGTTTATTTTGTGTGG + Intergenic
931017485 2:58001342-58001364 TTAACTATTATTATTTTGTTTGG + Intronic
931328850 2:61258320-61258342 TTGACTATTTTTATTTTTTGAGG - Intronic
932812943 2:74839399-74839421 TTGTCTATGTTAATTTTGATTGG + Intronic
933193277 2:79361087-79361109 TTAACTATTATTACTTTCTTGGG + Intronic
934725102 2:96611454-96611476 TTGACTATATTTACTATTTGTGG - Intronic
937067411 2:119028339-119028361 TTGACTTTGTTTTGTTTTTTCGG + Intergenic
938268106 2:129944002-129944024 GTCACTATGTTTTCTTTGCTGGG + Intergenic
938488726 2:131744547-131744569 TTGACTTTTTTTTCTTTCTTTGG + Intronic
939328657 2:140729370-140729392 TTGCCTATGCTTACTGTGTAAGG + Intronic
939349095 2:141009866-141009888 TTTTCTATGTTTAATTTGTGTGG - Intronic
940748075 2:157593354-157593376 ATTACTACGTTTCCTTTGTTTGG + Intronic
940915244 2:159247815-159247837 TAGTCTATGTTGACTTTGTCTGG - Intronic
942059841 2:172218188-172218210 TTGAATATGTTTAATTTGTAAGG + Intergenic
942162869 2:173210410-173210432 TTCTCTGTGTTTACTTTGTTAGG + Intronic
943155894 2:184176340-184176362 ATGATTATGTATACTTTATTTGG - Intergenic
943824474 2:192371848-192371870 TTGAAAATGATTGCTTTGTTGGG + Intergenic
944397747 2:199288829-199288851 TTGACTTTGTTTACCCAGTTTGG - Intronic
944671350 2:201996781-201996803 TTGAATATGGTTGCTGTGTTTGG + Intergenic
945954367 2:216071929-216071951 TTGACTATTTTTGCTTTGAATGG + Intronic
946314702 2:218902882-218902904 TTTTCTATGTTTATTTTGTGTGG - Intergenic
946674684 2:222146337-222146359 TTGATAATGTTTAATTTGGTTGG - Intergenic
947292159 2:228587996-228588018 TTCAGTATGTTTAGCTTGTTAGG - Intergenic
1169764168 20:9130804-9130826 ATGACTAAGTTTGCTTTGCTTGG - Intronic
1171220119 20:23388875-23388897 TTGTCTATTTTTTCTTTGTCTGG - Intronic
1173219930 20:41124223-41124245 TTGATTATTTTTCCTTTTTTTGG - Exonic
1175287663 20:57848228-57848250 TTGAATATATTGTCTTTGTTGGG + Intergenic
1177581990 21:23035875-23035897 CTGTCTGTGTTTACTTTATTGGG + Intergenic
1178181701 21:30169121-30169143 TTGAGTATGTTTATTTTCTAAGG - Intergenic
1178747595 21:35267949-35267971 TTGAGCATGTTTTCATTGTTGGG - Intronic
1178876751 21:36419929-36419951 TGGACTTTGTTTGCTTTGGTAGG + Intergenic
1180892638 22:19301233-19301255 TTGACTACCTTTTGTTTGTTTGG - Intergenic
1181345051 22:22213892-22213914 TTGATTTTGTTTAATTTGGTGGG - Intergenic
1181661538 22:24353816-24353838 TTAACTTTGTTCACTTGGTTAGG + Intronic
1183644212 22:39113781-39113803 TTAACTATACTTACATTGTTTGG - Intergenic
1184306149 22:43603540-43603562 TTGAGTATGTTCACATTGATTGG + Intronic
949131296 3:504641-504663 TTGTATATGATTACATTGTTAGG + Intergenic
951798073 3:26564207-26564229 TTGACTATGGTCACCCTGTTGGG + Intergenic
952536488 3:34315539-34315561 TTGTCCATGTTTGCTTTGGTTGG + Intergenic
953325213 3:42007238-42007260 TTGATTTTGTTTGTTTTGTTTGG + Intergenic
953464718 3:43109534-43109556 TTGACTATTTTTCCTTTGAAAGG + Intergenic
953697114 3:45168690-45168712 TTAACTATTTTTACAGTGTTTGG - Intergenic
954020518 3:47736779-47736801 TTGGATATGTTTTGTTTGTTGGG - Intronic
955324907 3:58002555-58002577 TTTTATATTTTTACTTTGTTTGG - Intergenic
955829710 3:62988000-62988022 TTGCTTATGTTTATTCTGTTCGG + Intergenic
958724772 3:97891318-97891340 TTGAGTGTGATTACATTGTTTGG - Intronic
959528717 3:107407964-107407986 TTGCCTATGTTAACTGTGATCGG - Intergenic
960192040 3:114718294-114718316 CTGAATATGTTTTCTGTGTTAGG + Intronic
960354379 3:116633100-116633122 TTGAATGTTTTAACTTTGTTTGG + Intronic
960432495 3:117586388-117586410 TTGAGGATGTTTACAGTGTTTGG - Intergenic
960749417 3:120930527-120930549 TTGACTTTTTTTTCTTTCTTTGG + Intronic
960808004 3:121602561-121602583 TTGACTATTTTTACTGTCATTGG + Intronic
961910094 3:130305577-130305599 CTGACAATGATGACTTTGTTTGG + Intergenic
962690171 3:137887901-137887923 TTTACTATTTTTACTTTAATTGG + Intergenic
962938215 3:140101132-140101154 TTGATAATGTCTACTTTATTAGG + Intronic
963576987 3:147073122-147073144 TTGACTATTTTTTTTTTGGTTGG - Intergenic
963677335 3:148328651-148328673 TTGGCTGTGTTTCCTTTGTTGGG + Intergenic
964582061 3:158250852-158250874 TTGTCCATGTTTGCTTTGGTTGG + Intronic
965019303 3:163207019-163207041 TTGACTTTATTTACTTTGAGTGG - Intergenic
965855968 3:173088573-173088595 TTGTGTATGTTTAATTTTTTTGG + Intronic
966167823 3:177041040-177041062 TTGACTATGTTTACTTTGTTGGG - Intronic
968269315 3:197390035-197390057 TTTACTATGTGCACTTTATTTGG + Intergenic
969855730 4:9997724-9997746 TTGCCTATTTTTTTTTTGTTAGG - Intronic
970141926 4:12992664-12992686 ATGACTATGTTTTCTTTGTGAGG + Intergenic
971009903 4:22422426-22422448 TTCACTGTGTTTACATTGTGAGG - Intronic
971416157 4:26432219-26432241 TTTATTATCTTTACTTTTTTGGG + Exonic
972927054 4:44022558-44022580 TTGACTATGTTTGCAAAGTTTGG + Intergenic
973264243 4:48195192-48195214 GTGACTAGGGTTACTTGGTTGGG + Intronic
973301710 4:48592423-48592445 TTTATTAGGTTTACTTTGTTAGG - Intronic
975728644 4:77316714-77316736 ATGACTATGACTAGTTTGTTAGG + Intronic
976544236 4:86315599-86315621 TAGAAAATGTTTACATTGTTGGG - Intronic
977562879 4:98550541-98550563 TTGTCTATGATTACTTTCATCGG + Intronic
977651335 4:99473073-99473095 CTGACGTTGTTTGCTTTGTTGGG - Intergenic
978061108 4:104340616-104340638 TTGACTATGTTTATATATTTTGG - Intergenic
978067848 4:104428016-104428038 TTGAATATGTTTCCCTTATTTGG - Intergenic
980153435 4:129077218-129077240 TTGTCTATATAAACTTTGTTAGG - Intronic
981138878 4:141244140-141244162 ATTACTAAGTTTACTTTGTTAGG - Intergenic
981322483 4:143408982-143409004 TGGACAAGGTATACTTTGTTAGG + Intronic
981883704 4:149647255-149647277 TTGATTATATTTACTATTTTTGG + Intergenic
982032026 4:151310375-151310397 TTGATTTTTTTTTCTTTGTTTGG - Intronic
982148854 4:152429339-152429361 TTGATTTCTTTTACTTTGTTAGG + Intronic
983687138 4:170423902-170423924 TTGACTTTCTTTTCTTTTTTTGG + Intergenic
984416829 4:179471404-179471426 TTGTCTGTTTTTACTTTGCTGGG - Intergenic
986930759 5:12818151-12818173 TTGAATATTTTTACTTTCTATGG - Intergenic
987396985 5:17433398-17433420 TGGGCTATATTTATTTTGTTGGG + Intergenic
987829058 5:23072798-23072820 GTGACTATGGCTACTTTGTGTGG - Intergenic
987973880 5:24986322-24986344 TGGACTATGTTTAATCTTTTAGG + Intergenic
988134055 5:27146290-27146312 TTGTTTGTTTTTACTTTGTTTGG - Intergenic
988339412 5:29950525-29950547 TTTAAAATGCTTACTTTGTTGGG + Intergenic
988947944 5:36225373-36225395 TTGACCATGTTCACATTCTTGGG - Intronic
989384523 5:40841671-40841693 TTGACTTTGTATACTTTTTGGGG + Intronic
990674693 5:58170390-58170412 TTGACAATGTTGACTTGTTTGGG - Intergenic
991138697 5:63214071-63214093 TTCCATATTTTTACTTTGTTGGG - Intergenic
991139420 5:63222706-63222728 TTGATAATGTTTACTATGGTTGG + Intergenic
993356905 5:86924617-86924639 ATGACAATGTTAAGTTTGTTTGG - Intergenic
993422830 5:87722541-87722563 TTAAATATGTTTGCTTTGTTAGG + Intergenic
993618315 5:90138603-90138625 GTGTCTATGTTTGCTTTGCTGGG + Intergenic
993849816 5:92993321-92993343 TTTACTGTATTTACTTTATTTGG - Intergenic
994149157 5:96428447-96428469 TAGAAAATGTTTACTATGTTGGG - Intronic
994438051 5:99763577-99763599 ATGACTTTGTTTACATTGTGAGG + Intergenic
994640894 5:102408464-102408486 TTGATTATGTTTATTTTGCTTGG - Intronic
995022483 5:107382048-107382070 TTGACTATTTTTATTTTTATCGG + Intronic
995504336 5:112843387-112843409 TTGGTTTTCTTTACTTTGTTTGG - Exonic
995904826 5:117110948-117110970 GTAACTATTTTAACTTTGTTTGG - Intergenic
996494721 5:124140673-124140695 TTGACTATGTTTCCTGTTATGGG - Intergenic
996671695 5:126124911-126124933 TTGACTATGCCTATTTTTTTTGG - Intergenic
997125004 5:131217194-131217216 TTGTCTATGGCTACTTTCTTTGG + Intergenic
997135986 5:131326776-131326798 TTTATTATGTTTATTTTTTTAGG + Intronic
998769233 5:145523354-145523376 TTGAATATATGAACTTTGTTAGG - Intronic
998799390 5:145853844-145853866 TTGACCATGTCTGCTTTCTTAGG - Intergenic
999982948 5:156975461-156975483 TTCACTATGTTTCCTTTGTCTGG + Intergenic
1000564369 5:162829673-162829695 GGTACTATGTTTACTGTGTTAGG - Intergenic
1001992642 5:176130594-176130616 TTGAATATGTTTTCTTTCATTGG - Intronic
1002002357 5:176204015-176204037 TTGAATATGTTTTCTTTCATTGG - Intergenic
1002403345 5:179007243-179007265 TTGAGTATTTTTTCCTTGTTTGG - Intergenic
1003311992 6:4977156-4977178 TTGGCTATGTGTACTTTTTTTGG + Intergenic
1004544041 6:16579650-16579672 TTGGCTATGTTTATTTGTTTAGG + Intronic
1005221857 6:23596502-23596524 TTTACTATCTTGACTTGGTTGGG + Intergenic
1006125711 6:31836584-31836606 GTGACTATTTTTACTTTTTTGGG + Intronic
1006532367 6:34667180-34667202 TTCACTATGTTTACATTATTTGG - Intronic
1006590809 6:35155457-35155479 TTCACTTTATTTTCTTTGTTGGG + Intergenic
1007873768 6:45071065-45071087 TTGTCTCTGTTTACCTTTTTTGG + Intronic
1008014610 6:46504276-46504298 TTTACTTTGTTTTGTTTGTTTGG - Intergenic
1008513536 6:52298956-52298978 CTGACTTTTTTTACTTTGTGAGG + Intergenic
1010062604 6:71641660-71641682 TTGATTACGTATTCTTTGTTAGG + Intergenic
1011529693 6:88308163-88308185 TTGAATATTTTTAACTTGTTAGG + Intergenic
1012614942 6:101265787-101265809 TTGACTATTTTTACTTTATATGG + Intergenic
1013419413 6:109952463-109952485 TTGACTATCTTTAGTGTGATTGG + Intergenic
1014162542 6:118186574-118186596 TTGACTAAGTTTACTGGGATTGG + Intronic
1014453611 6:121611376-121611398 TGGATTTTGTTTTCTTTGTTTGG + Intergenic
1014610976 6:123546091-123546113 TTGACTATGTTCACTCTCTATGG + Intronic
1014968146 6:127782080-127782102 GTGGCTTTGTTTACATTGTTAGG + Intronic
1015000781 6:128212081-128212103 TAGACTATTTTTTATTTGTTAGG + Intronic
1015639198 6:135312556-135312578 TTGTTTTTGTTTTCTTTGTTTGG - Intronic
1016303702 6:142659941-142659963 TTTACTATGTTTACTTTTCACGG - Intergenic
1021376235 7:19910571-19910593 TTCACTTTGTTTACTTTGTCAGG - Intergenic
1021828432 7:24577658-24577680 TGCACTATGTTCACTCTGTTGGG + Intronic
1022050097 7:26658621-26658643 TTCACTTCGTTTTCTTTGTTTGG + Intergenic
1022430025 7:30309641-30309663 TTGAATGTGTGTACTATGTTTGG + Intronic
1022991642 7:35714487-35714509 TTGACAGTGTTTCCTTTGCTGGG - Intergenic
1023162912 7:37314775-37314797 ATGATGATGTTTTCTTTGTTCGG - Intronic
1023489816 7:40726988-40727010 ATGACTATGTATATTGTGTTTGG + Intronic
1023756409 7:43422208-43422230 TTGGTTATGTTTAAATTGTTTGG - Intronic
1024124085 7:46273723-46273745 ATAACTATCCTTACTTTGTTTGG - Intergenic
1024356642 7:48420363-48420385 GTTACAATGTTTACTTTGTGTGG + Intronic
1027570134 7:79855657-79855679 TTAACTATTCTTACTGTGTTAGG - Intergenic
1028339767 7:89704373-89704395 TTGCCTATGATTACTCTGATTGG - Intergenic
1028823180 7:95236605-95236627 TTGAATATTTTTACTTTTTTAGG + Intronic
1030183352 7:106733791-106733813 TTGAGAATGATTCCTTTGTTTGG + Intergenic
1031060753 7:117048798-117048820 TTCATTATGTTCCCTTTGTTGGG + Intronic
1031479614 7:122262466-122262488 GGGATTATGTTTTCTTTGTTTGG + Intergenic
1032749857 7:134827888-134827910 TTGAATATGTTGCCCTTGTTGGG - Intronic
1038155603 8:24986600-24986622 GAGACTAAGTTTACTGTGTTAGG - Intergenic
1039107080 8:34001532-34001554 TTGACTCTGCTTACTTGATTGGG + Intergenic
1039222909 8:35355352-35355374 TTAATTTTCTTTACTTTGTTAGG + Intronic
1039926385 8:41936451-41936473 ATGAGCATTTTTACTTTGTTGGG - Intronic
1041066568 8:54087884-54087906 ATGACTCTGTCTCCTTTGTTCGG - Intronic
1041939131 8:63367481-63367503 ATGACTCTGTCTCCTTTGTTAGG - Intergenic
1042749791 8:72145848-72145870 TTTTGTATGTTTGCTTTGTTAGG + Intergenic
1043320784 8:78983147-78983169 TTGACTATGTTAACTAAGCTAGG - Intergenic
1044029635 8:87219775-87219797 GTGACTATTTTAACATTGTTTGG - Intronic
1044343196 8:91070910-91070932 TTGAATATGTTTCGGTTGTTTGG - Intronic
1044681727 8:94785860-94785882 GTGACTTTGTTTTCTTTGATTGG + Intronic
1044920256 8:97162627-97162649 TTGATTATTTTTACTTTTTGTGG - Intergenic
1045304641 8:100948936-100948958 TTGAGTCTGTTTATTTTGATGGG - Intronic
1046019767 8:108650556-108650578 TTGACTATGTTGGCCTTGTTTGG + Intronic
1046105665 8:109662935-109662957 TACAATATGTTTACTGTGTTTGG - Intronic
1046304819 8:112352223-112352245 TTGACTAAATTTGTTTTGTTTGG - Intronic
1046340613 8:112849500-112849522 TTGGCTACCTTTACTTTGTTAGG - Intronic
1047818708 8:128494554-128494576 TGAACTATGTTGACTTAGTTTGG + Intergenic
1048583102 8:135746800-135746822 TAGACTATTTTTATTTTTTTTGG + Intergenic
1048901827 8:139045402-139045424 TTTCCTATGTTTATTTTTTTTGG - Intergenic
1049461765 8:142733019-142733041 ATGACCCTGTTTCCTTTGTTGGG - Intronic
1049851246 8:144832039-144832061 TTGTGTTTGTTAACTTTGTTAGG + Intronic
1050194738 9:3069663-3069685 CTGACTCAGTTTAGTTTGTTTGG - Intergenic
1050344523 9:4673253-4673275 TGGAATATGTGGACTTTGTTGGG + Intergenic
1050963984 9:11772967-11772989 TTGTCTATTTTTACTGTTTTTGG + Intergenic
1051576839 9:18625581-18625603 TTGACTATTTTTATTGGGTTGGG - Intronic
1052183317 9:25558655-25558677 TTGACTTTGTTTAATATATTTGG + Intergenic
1053262635 9:36682693-36682715 TGGAAAATGTTTGCTTTGTTTGG - Intergenic
1053626889 9:39881931-39881953 ATTCCTATGTTTACTTAGTTTGG - Intergenic
1054216997 9:62368772-62368794 ATTCCTATGTTTACTTAGTTTGG + Intergenic
1055194686 9:73574643-73574665 ATAAATATGTTTACTTTCTTAGG - Intergenic
1055517993 9:77052515-77052537 TAGACAATTTTTTCTTTGTTGGG - Intergenic
1056946310 9:91000362-91000384 TTAAACATGTTGACTTTGTTTGG - Intergenic
1058102786 9:100935874-100935896 TTGCTGATGTTTACTTTGTATGG + Intergenic
1058554054 9:106147434-106147456 TTTATTATGTTTACTTCATTGGG - Intergenic
1060800132 9:126538884-126538906 GGGACCATGTTTATTTTGTTTGG - Intergenic
1060854418 9:126903548-126903570 TTGACTATGTTGACTATGTTAGG - Intergenic
1061901753 9:133676432-133676454 TTAAGTATGTTCACATTGTTGGG - Intronic
1186368227 X:8918596-8918618 TTCATTATGTTTACATTTTTGGG + Intergenic
1186675804 X:11816118-11816140 GAGATTCTGTTTACTTTGTTTGG - Intergenic
1187172241 X:16863401-16863423 TTGTCTGTGTTTACTGAGTTGGG - Intronic
1188027819 X:25229244-25229266 TTGACTATATTTGCTGTGCTGGG - Intergenic
1188239491 X:27768255-27768277 TTGACTGAATTTACTTTGTCTGG - Intergenic
1188442785 X:30229741-30229763 TTGATTATAATTTCTTTGTTTGG + Intergenic
1191920003 X:66245924-66245946 GTGCCTATGTTTCTTTTGTTGGG + Intronic
1191922926 X:66276722-66276744 TTGACTATAGTCACCTTGTTTGG - Intergenic
1192617003 X:72635913-72635935 TAAATTATGTTTTCTTTGTTTGG - Intronic
1193431479 X:81411698-81411720 TTGACTATGTTTTCATTTTCTGG + Intergenic
1193964676 X:87970994-87971016 GTGACTTTATTTAGTTTGTTGGG - Intergenic
1194063694 X:89236418-89236440 TTAACTTTGTTTCCTTTGTTAGG - Intergenic
1194108937 X:89807067-89807089 TTAACTATGTTTCATATGTTAGG + Intergenic
1194359510 X:92932132-92932154 AAGAGTATGTTTACTTTGGTAGG - Intergenic
1194370704 X:93067592-93067614 TTGCCTTTTTTTACTTTTTTTGG - Intergenic
1194878556 X:99220562-99220584 TTGACTTTGTATATTTTCTTTGG - Intergenic
1195281175 X:103334657-103334679 ATAACTATGATTACTTTCTTAGG - Intergenic
1195334530 X:103837963-103837985 TTGAATATATTTTCTTTGATAGG - Intergenic
1195814936 X:108874511-108874533 TTGATTATGTCTACTTTGCCAGG + Intergenic
1195817166 X:108901780-108901802 TTGTCTATTTTCACTTTTTTTGG - Intergenic
1196202067 X:112897676-112897698 TTTACTATGTTTTCCTTCTTAGG - Intergenic
1196375703 X:115030426-115030448 ATGACTATTTTTAATTTTTTTGG - Intergenic
1198625136 X:138563747-138563769 TTCACTATGTTCACTTTGTCAGG + Intergenic
1198941321 X:141959597-141959619 TAGACTTTATTTACTTGGTTTGG + Intergenic
1199715017 X:150501610-150501632 TTGACTTTGTTGTTTTTGTTTGG + Intronic
1200461594 Y:3461802-3461824 TTAACTATGTTTCATATGTTAGG + Intergenic
1200678497 Y:6179485-6179507 TTGCCTTTTTTTACTTTTTTTGG - Intergenic
1200717866 Y:6570524-6570546 TTAACTTTGTTTCTTTTGTTAGG - Intergenic
1201692443 Y:16781981-16782003 TTGACTATTTTTTGTTTGATTGG - Intergenic
1202054527 Y:20815471-20815493 ATGCCTATGTTTCTTTTGTTGGG - Intergenic