ID: 966174851

View in Genome Browser
Species Human (GRCh38)
Location 3:177126969-177126991
Sequence ATGTTGTTTTTGCTGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966174851 Original CRISPR ATGTTGTTTTTGCTGAAACT GGG (reversed) Intronic
900153728 1:1194824-1194846 AGGTTGTTTTTCATTAAACTGGG + Intronic
900202068 1:1412656-1412678 TTGTTGTTTTTTCTTAAAATAGG + Intergenic
900957161 1:5893091-5893113 AAGTTGTTTTTTCTGTCACTGGG - Intronic
901334043 1:8433439-8433461 TTTTTGTGTGTGCTGAAACTAGG - Intronic
902087860 1:13877022-13877044 ATGTTGTTTTTGTAGAGACAGGG + Intergenic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
904299552 1:29545439-29545461 ATATTGCTGTTGCAGAAACTTGG + Intergenic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
907445202 1:54503195-54503217 ATTTTGGTTTTGCTGAATTTTGG - Intergenic
908057322 1:60303394-60303416 ATGATTTTTGTGTTGAAACTGGG + Intergenic
908083780 1:60608780-60608802 CTGTTGTTTTAGCTGACTCTTGG - Intergenic
908177407 1:61569412-61569434 ATGTTTTATTGGCTCAAACTAGG - Intergenic
908899423 1:68939122-68939144 AGGCTATTTTTGCTGACACTTGG + Intergenic
909251469 1:73362236-73362258 AAGTTGTTTTTGGTGATTCTAGG - Intergenic
909512296 1:76468035-76468057 ATTTTTTTTTTGCTAAAATTAGG + Intronic
909726131 1:78837895-78837917 GTGTTTTTTTTCCTTAAACTAGG - Intergenic
912884613 1:113457106-113457128 AGGTTGTGTTTGCTTAAAGTTGG + Intronic
913402636 1:118453687-118453709 TTGTTCTTTTTGCTTAATCTTGG - Intergenic
913663029 1:121021438-121021460 TTGTTGGGTTTGCTGGAACTCGG - Intergenic
913699180 1:121357582-121357604 ATTTAGTTCTTACTGAAACTGGG + Intronic
914014412 1:143804703-143804725 TTGTTGGGTTTGCTGGAACTCGG - Intergenic
914138365 1:144922463-144922485 ATTTAGTTCTTACTGAAACTGGG - Intronic
914163407 1:145156498-145156520 TTGTTGGGTTTGCTGGAACTCGG + Intergenic
914653037 1:149713260-149713282 TTGTTGGGTTTGCTGGAACTCGG - Intergenic
915090954 1:153425760-153425782 ATGTTGTTGTTGTAGAAACTGGG - Intergenic
916089246 1:161294301-161294323 ATTTTTTTTTTTCTGAAACAGGG + Intergenic
916986884 1:170201408-170201430 ATGTTGGTTTTGATGATAATAGG - Intergenic
917000231 1:170349700-170349722 CTAGTGTTTTTGCTGAAGCTAGG - Intergenic
918858125 1:189785626-189785648 TTGTTGTTTTATCTGAACCTAGG - Intergenic
919496681 1:198280675-198280697 AAGTTGATTTTGATAAAACTTGG - Intronic
920320018 1:205113114-205113136 TTGTTGTTGTTGCTGAGACAGGG - Intronic
920486590 1:206376294-206376316 ATTTAGTTCTTACTGAAACTGGG + Intronic
920552513 1:206874640-206874662 TTGTTGTTATTGCTGAGACTGGG - Intergenic
920588201 1:207189432-207189454 AAGTTGTATTTGCTAAACCTAGG - Intergenic
920668569 1:207985008-207985030 ATGTTGTTTTGGTTGAAATATGG + Intergenic
920715382 1:208335642-208335664 ATGTTGTTTTTACTGAAGTGGGG + Intergenic
921100164 1:211921909-211921931 TTGTTGTTTTTGCAGAGACAGGG - Intergenic
921777156 1:219114364-219114386 AGTCTGTTTTTTCTGAAACTAGG - Intergenic
923544957 1:234917448-234917470 ATGTTGAATTACCTGAAACTAGG - Intergenic
1063492102 10:6473487-6473509 ACGTTGTTATTTCAGAAACTGGG - Intronic
1063757707 10:9033316-9033338 TTGTTGTTGTTGTTGAAAGTTGG - Intergenic
1065160385 10:22913978-22914000 ATGTAATTTTTAATGAAACTTGG - Intergenic
1065439652 10:25738342-25738364 AAGTGGTGGTTGCTGAAACTTGG - Intergenic
1067260856 10:44690162-44690184 ATTTTGTTGTTGTTGAAAATTGG + Intergenic
1068768347 10:60790975-60790997 TTGTTGTTTTTGCTCAAGATTGG + Intronic
1069000345 10:63256198-63256220 ATGTTATTTTGACTGAAATTTGG - Intronic
1070913580 10:80138401-80138423 ATGGTGTTATTGCTGAATCTGGG - Intronic
1071893993 10:90044228-90044250 ATGTTTGATTGGCTGAAACTTGG + Intergenic
1072688782 10:97555867-97555889 TTGTTGTTTTTTCTTAAAATGGG + Intronic
1072689393 10:97561732-97561754 TTGTTGTTTTTTCTTAAAATGGG + Intronic
1073195021 10:101683452-101683474 GTGTTGTTTTTGTTTAAAATAGG - Intronic
1073219750 10:101861333-101861355 ATGATGTTTTTGCTGGACGTAGG - Intronic
1073652200 10:105373224-105373246 ATATTGCTTTTGCTGAAAACTGG - Intergenic
1074195579 10:111181710-111181732 TTGTTGTGTCTTCTGAAACTTGG + Intergenic
1074203488 10:111260107-111260129 AAGCTGCTTTTGCTGAAGCTAGG - Intergenic
1075336487 10:121612627-121612649 ATGTTGGTTTCCCTCAAACTTGG + Intergenic
1076050848 10:127332082-127332104 ATGCTGTTTTGGTGGAAACTGGG + Intronic
1076647944 10:131966564-131966586 GAGTTGTTTTTTCTGAAACAGGG + Exonic
1079944047 11:26719062-26719084 TAGTTGTTTTTGCAGTAACTAGG + Intronic
1080634944 11:34115662-34115684 AAATGGTATTTGCTGAAACTGGG - Intronic
1081314477 11:41614856-41614878 CTTTTGTTTTTACTGGAACTTGG + Intergenic
1082258858 11:50062355-50062377 ATGTTATTTTTGCAGAGACAGGG + Intergenic
1083083825 11:60122042-60122064 ATGTTTGTTTTCCTGCAACTAGG - Intergenic
1083277618 11:61606123-61606145 ATCTTCATTTTGCAGAAACTGGG - Intergenic
1084271532 11:68031810-68031832 ATGTTGTTTTTGGTTAGATTTGG + Intronic
1084663496 11:70561533-70561555 TTGTTGTTGTTGCTGAGACAGGG + Intronic
1084724976 11:70935599-70935621 ATGAGGTCTTTTCTGAAACTGGG + Intronic
1085698383 11:78725043-78725065 ATTTTGGCTTTTCTGAAACTTGG + Intronic
1088033579 11:105283077-105283099 TTGTTGTTGTTGCTTAAACTTGG + Intergenic
1088071962 11:105798016-105798038 GTGTTATTATTGCTGAATCTAGG - Intronic
1088811022 11:113392440-113392462 ATGTGGTTTTTCCTGAAGGTTGG + Intronic
1088864106 11:113830082-113830104 ATGTATTTTTTGGAGAAACTGGG - Intronic
1089889312 11:121864488-121864510 ATATTGTTTTTGCAGAATCTAGG + Intergenic
1092313500 12:7383957-7383979 ATTTTCTTTTTGCTGAAATGTGG - Intronic
1093588866 12:20875060-20875082 ATTTTGTTATCTCTGAAACTAGG - Intronic
1093739734 12:22670985-22671007 ATTTTGCTTTTGCTTAAACTTGG + Intronic
1094260029 12:28484348-28484370 CTGTTGTTTTTGCTGACAGATGG - Intronic
1094407172 12:30128673-30128695 ATTTTGTTTTTTCTGAAAAGTGG - Intergenic
1095369408 12:41448846-41448868 ATCTTATTGTTTCTGAAACTGGG - Intronic
1097461912 12:59872659-59872681 ATGTTGTTTTTGTTTCAACTTGG - Intergenic
1097895604 12:64822351-64822373 ATTTTATTTTTGCAGAAACAGGG + Intronic
1098802659 12:74981751-74981773 AGGTTGTGTTTCCTGCAACTGGG - Intergenic
1099220487 12:79908402-79908424 TTGAATTTTTTGCTGAAACTAGG + Intronic
1099395890 12:82138165-82138187 ATGTTGTTTTTGCAAAATCAAGG - Intergenic
1099622689 12:85024992-85025014 ATTTTTTTTTCTCTGAAACTAGG - Intronic
1099703045 12:86113584-86113606 ATGTAGTTTTTACTAAAATTTGG + Intronic
1099859347 12:88208337-88208359 AGGTTGTTGCTGCTGAGACTAGG + Intergenic
1101942557 12:109110920-109110942 ATGCTGTTTTTGCTGTTAGTCGG + Exonic
1103409122 12:120698352-120698374 CTGTTGTTTTCGCTGTGACTTGG + Exonic
1105594157 13:21820363-21820385 ATGTCCTTGTTGCAGAAACTGGG + Intergenic
1107456767 13:40562733-40562755 CTGGTGTTTCTGCTGAAACTTGG - Intronic
1107757834 13:43644882-43644904 ATGTTTTTTAGGCTTAAACTTGG - Intronic
1108761054 13:53565377-53565399 ATGTATTTTTTGCTGTTACTGGG + Intergenic
1109492987 13:63127846-63127868 ATATTGTTTTTGCTTAAGATGGG + Intergenic
1109916832 13:69000005-69000027 AGTCTGTTTTTTCTGAAACTAGG - Intergenic
1109981972 13:69920990-69921012 ATGTTGTTTTAGCACCAACTTGG + Intronic
1110239562 13:73252128-73252150 ATTTTGTTTCTGCTGAAATTGGG - Intergenic
1110347691 13:74467190-74467212 ATTTTTTTTTCTCTGAAACTGGG + Intergenic
1111620749 13:90722244-90722266 ATGTTTTTTTTTCTTAAACATGG - Intergenic
1112194607 13:97212858-97212880 TTGATGTTTTCGCTGAAACATGG + Intergenic
1112474807 13:99721772-99721794 ATGTTGTACTTGCTGACCCTTGG + Intronic
1113238731 13:108313138-108313160 ATGTTGCTCTGGCTAAAACTTGG - Intergenic
1113279373 13:108772174-108772196 ATATTTTTTTTGCAGAAACTGGG - Intronic
1113363381 13:109652609-109652631 TAGTTGCTTTTGCTGAATCTTGG - Intergenic
1116358955 14:43968656-43968678 TTTTTTTTTTTGCTGAAACATGG + Intergenic
1117326854 14:54676980-54677002 TTGTTGTTCCTGCTGAAACACGG + Intronic
1117361467 14:54979326-54979348 AATTTTTTTTTGTTGAAACTGGG + Intronic
1118697868 14:68402522-68402544 AAGTTGTGTTTGCTGGGACTTGG + Intronic
1119674084 14:76540789-76540811 ATTTTGTAATTGCTTAAACTGGG - Intergenic
1120903086 14:89592924-89592946 ATTTTGTTGTTGCTCAAACTTGG - Intronic
1121409791 14:93741838-93741860 CTGTTGTGTTTGCAGAATCTTGG - Intronic
1122240339 14:100360893-100360915 ATGCTGTTTTGCCTGAGACTGGG + Intronic
1122321871 14:100860289-100860311 TTGATGTTTTTCCTAAAACTCGG - Intergenic
1123149601 14:106168149-106168171 ATGTGGTTTTTCCAGAAACATGG + Intergenic
1123181420 14:106474285-106474307 ATCATGTTTTTGCAGCAACTTGG + Intergenic
1202945482 14_KI270726v1_random:22442-22464 ATCATGTTTTTGCAGCAACTTGG - Intergenic
1124067266 15:26355811-26355833 ATGTTGTGCTTGCTGAAAGCCGG - Intergenic
1124621434 15:31276315-31276337 ATCTGGTTTTTGTAGAAACTAGG + Intergenic
1124689409 15:31809503-31809525 AAGTTTTTTTGGCTGGAACTGGG - Intronic
1124689951 15:31813446-31813468 ATGTGGCATTTGCTGAATCTTGG - Intronic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1127478459 15:59356607-59356629 TTGTTGTTTTTCCTGAAACAGGG + Intronic
1127933312 15:63612179-63612201 TTGTTGTTTTTGTTGAGACAGGG - Intronic
1128916308 15:71566159-71566181 TTTTTTTTTTTGCTGAAATTCGG + Intronic
1128934529 15:71733979-71734001 TTGTTGTTATTGCTGAAATGGGG + Intronic
1129186858 15:73913122-73913144 TTGTTGTTGTTGCTGAGACCGGG + Intergenic
1129947647 15:79554534-79554556 ATATTGGTTTTGCTGAAGCTAGG + Intergenic
1130572915 15:85064791-85064813 TTGCTGTTGTTGCAGAAACTGGG - Intronic
1130681795 15:86003385-86003407 ATGTAGTATTTGCTGATACTGGG - Intergenic
1130770775 15:86921387-86921409 GAGTTGTTTTTTCAGAAACTTGG - Intronic
1130929218 15:88410486-88410508 TTGTTGTTTTTGATAAAATTTGG + Intergenic
1131404222 15:92150626-92150648 ATGTTGGTTTTGCTGAGATCAGG - Intronic
1131746961 15:95459083-95459105 ATTTTTTTTTTCCTGAAAATAGG - Intergenic
1132150911 15:99457932-99457954 ATGTTCTCTTTGTTCAAACTGGG - Intergenic
1133539461 16:6735140-6735162 TTGTTGTTTTTGTTGAGACAGGG - Intronic
1133600090 16:7331273-7331295 ATATAGATTTTGTTGAAACTGGG - Intronic
1135468470 16:22707931-22707953 TTGTTGTTTTTTCTGAGACAGGG + Intergenic
1137667198 16:50258347-50258369 GTGGTGTTTTTGTTGAAGCTGGG + Intronic
1137762454 16:50951408-50951430 TTGTTTTTTTTACTGAAACATGG + Intergenic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1139059089 16:63226664-63226686 ATGTTTCTTTTGATGAATCTGGG - Intergenic
1139742835 16:69050348-69050370 TTTTTGTTTTTTCTGAAACGGGG + Intronic
1140100900 16:71915835-71915857 TTGTTGTTTTTGTTGAGACAGGG + Intronic
1140277995 16:73527960-73527982 TTGTTGTTTCTGCTAAATCTTGG + Intergenic
1141288880 16:82699038-82699060 ATGTTTTTTCTTCTTAAACTAGG - Intronic
1142946172 17:3430145-3430167 TTGGTGTTTTTGTTGAAAATTGG - Intergenic
1142947841 17:3448852-3448874 ATATTGATTTTGTTGAAAATTGG + Exonic
1143143044 17:4753742-4753764 ATGTTCTTTTTGCAGAAGGTGGG - Intergenic
1144148016 17:12416720-12416742 ATGTTTTTCTGGCTGAAATTGGG + Intergenic
1146234248 17:31143441-31143463 ATGTTTTTTTTGTAGAAACAGGG + Intronic
1146247853 17:31306434-31306456 ATGTTGAATTTGCTGATAGTGGG - Intronic
1146774753 17:35603896-35603918 CTATTGTGTCTGCTGAAACTGGG + Intronic
1147552660 17:41455368-41455390 CTGTTGTTGTTTCTGAAACTTGG + Intergenic
1147881797 17:43659098-43659120 ATTTGGGTTTTGCTGAGACTCGG + Intronic
1147944608 17:44073764-44073786 TTTTTGTTTTTGTTGAATCTGGG + Intronic
1148136427 17:45295150-45295172 ATGTTGTACTTGCTAAAACAGGG - Intronic
1149465969 17:56879400-56879422 CTGTTCTTGTTGCTGAAACAAGG + Intergenic
1149919189 17:60640297-60640319 CTTTTGTTTTTTCTGAAACAGGG - Intronic
1151022565 17:70634579-70634601 TTGTTGTTTTTTCAGAAACAGGG - Intergenic
1151216920 17:72583285-72583307 AAGTTGTTGTTGCTGAAGTTGGG - Intergenic
1156032336 18:32726874-32726896 ATGTTTATTCTGCTGAAAGTGGG - Intronic
1156330373 18:36115844-36115866 CTCCTGTTTTTCCTGAAACTTGG - Intronic
1156389845 18:36640002-36640024 ATATTATTTCTGCTGAAACATGG - Intronic
1156412089 18:36840286-36840308 TTGTTTTGTTTTCTGAAACTAGG + Intronic
1158289380 18:55921866-55921888 ATGTTATTTTTCCTGGAAATAGG - Intergenic
1158490448 18:57905531-57905553 ATGTTATTTTTGTAGAAATTGGG - Intergenic
1158583837 18:58710899-58710921 AATTTGTTTTTTCTGAAACAAGG + Exonic
1158799315 18:60887859-60887881 CTGTAGTTTTTGCTGAAACAAGG - Intergenic
1159759832 18:72410420-72410442 ATTTAGTTTTAACTGAAACTTGG - Intergenic
1162593612 19:11610017-11610039 ATTTTGTTTTTGTTGAAAAGTGG + Intronic
1163439611 19:17315062-17315084 ATATGGTTTTTGGTGAAACAGGG - Intronic
1164328073 19:24219780-24219802 ATGCTGTTTTTGTAGAATCTAGG - Intergenic
1168502375 19:56904195-56904217 ATAATGTTTTTGCAGCAACTTGG - Intergenic
927104859 2:19814911-19814933 TTGTTTTTTTGACTGAAACTTGG - Intergenic
927290865 2:21403653-21403675 CTCTTATTTTTTCTGAAACTTGG - Intergenic
928466386 2:31526803-31526825 ATTTTTTTTTTTCTGAAACTAGG + Intronic
931401064 2:61931999-61932021 TTGTTGTTTTTTCTGAGACAGGG + Intronic
931776321 2:65544123-65544145 TTTTTTTTTTTGCAGAAACTGGG + Intergenic
931865197 2:66402290-66402312 TTGTTGTTGTTGTTGAGACTGGG - Intergenic
933324038 2:80813513-80813535 TTTTTTTTTTTTCTGAAACTTGG + Intergenic
935538098 2:104317917-104317939 AAGTTGTTTTAGCTGAAAAATGG + Intergenic
935804712 2:106734219-106734241 ATGTTGTTTGTCCTGAATGTAGG - Intergenic
936048450 2:109204434-109204456 CTGTAGTTTTTGTTAAAACTGGG + Intronic
938159035 2:128967564-128967586 AGGTTGTGGTTGCTGAAAGTTGG - Intergenic
938255053 2:129851368-129851390 TTGTTGTTGTTGCTGAAAATTGG - Intergenic
938265985 2:129928640-129928662 ATGGTGTTATTGCTGAATCTGGG + Intergenic
938524326 2:132112458-132112480 TTGTTGTTGTTGCTGATATTTGG - Intergenic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939981008 2:148781719-148781741 TTGCTGTTTCTGCTGAAGCTGGG - Exonic
940966740 2:159846509-159846531 TTGTTGTTTTTTCTGACACAGGG - Intronic
941202753 2:162533050-162533072 ATTTTATTTTTGCTCAAAATAGG + Intronic
941204990 2:162561077-162561099 ATGTTGTTTTTACTGACTGTTGG + Intronic
941446756 2:165610294-165610316 ATGTTATGTTTGCGGAAATTTGG - Intronic
941959763 2:171242022-171242044 AAGTTGTTTTTGCAGAGACAGGG + Intergenic
942256264 2:174102143-174102165 ATATTGATGTTGCTGACACTTGG - Intronic
942309558 2:174642654-174642676 TTGTTGTTGTTGTTGAGACTGGG + Intronic
945216238 2:207437044-207437066 ATCTTGTTCATGCTGATACTAGG - Intergenic
945829967 2:214771913-214771935 TTTTTTTTTTTCCTGAAACTGGG - Intronic
946049458 2:216849893-216849915 ATGTTTTTGTTGAGGAAACTGGG + Intergenic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
947262527 2:228239650-228239672 TTGTTATTTATTCTGAAACTGGG + Intergenic
947292429 2:228591160-228591182 ATATAATTTTTGCTGAAATTAGG + Intergenic
948166409 2:235866193-235866215 ATGTTTTATTTTCTGAGACTAGG + Intronic
948432532 2:237929118-237929140 TTGTTGTTTTTGCTGAGATGGGG + Intergenic
948582700 2:238998679-238998701 ATGTTGTTTCTGCTCACATTTGG + Intergenic
1169355815 20:4904138-4904160 ATATTTTTTTACCTGAAACTTGG + Intronic
1169893369 20:10476964-10476986 CTCTTGGTTTTGCTGAAATTTGG - Intronic
1169911269 20:10649481-10649503 ATTTTGATTTTCATGAAACTTGG - Intronic
1171790686 20:29520643-29520665 CTGTTCTTATTCCTGAAACTGGG + Intergenic
1172319863 20:33987922-33987944 ATGTTCTTTATGCAGAAACTTGG + Intergenic
1175836355 20:61997985-61998007 ATGTTGTATTTATTTAAACTTGG + Intronic
1177208552 21:18040552-18040574 ATGGTATATTTGCTGATACTAGG + Intronic
1177225710 21:18252554-18252576 CTGATGATTTTGCTGCAACTTGG + Intronic
1178295218 21:31404117-31404139 ATGTTGTTTTTCCTGGAAAAGGG - Intronic
1179238806 21:39570454-39570476 TTGTTGTTTTTGTTGAGACAGGG + Intronic
1180904715 22:19401300-19401322 TTGTTGTTGTTGCTGAGACAGGG + Intronic
1182216856 22:28725900-28725922 ATTTTTTTTTTTTTGAAACTGGG - Intronic
1182786722 22:32914084-32914106 ATTTTGTGTTTGGGGAAACTGGG + Intronic
1184061615 22:42085986-42086008 ATGTGGTGTTTGCTGTAAATTGG - Exonic
1185214416 22:49590236-49590258 ATGTTATTTTGTCTGAAACAGGG + Intronic
949251003 3:1983759-1983781 TTGTAGTTTTTGTGGAAACTGGG - Intergenic
951629328 3:24701918-24701940 AGGATGTTTTTGCTGAATATAGG + Intergenic
952123637 3:30274797-30274819 ATGTTGGTTTTGGTGGAATTTGG - Intergenic
952227103 3:31389518-31389540 ATTTTGTTTTTTTTTAAACTTGG + Intergenic
952317990 3:32248534-32248556 GTGTTGTTTTAGTAGAAACTGGG + Intronic
952797373 3:37253074-37253096 ATTTTATTTTTGCAGAAACAGGG - Intronic
953887630 3:46725241-46725263 TTGTTGTTTTGTCTGAAACAGGG - Intronic
955215911 3:56984914-56984936 ATGTTGCTTTTGCTGATAGCAGG - Intronic
955541302 3:59979393-59979415 ATCTTGTTTTCCCTGAATCTTGG - Intronic
955938941 3:64129701-64129723 AGGTTGTTTGGGCTGAGACTCGG + Intronic
956828148 3:73018039-73018061 AGGTTGGTTTTGGGGAAACTAGG + Intronic
958853466 3:99356446-99356468 ATGATATTTTTGCTCAAACATGG - Intergenic
959880304 3:111437658-111437680 CTGTGGTTTCTGCTGAAACCTGG - Intronic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961489532 3:127244818-127244840 CTCATGTTTTTGCTGAAACCTGG - Intergenic
962300486 3:134237789-134237811 ATAGTGTTTTGGCTGACACTAGG - Intronic
963411910 3:144939198-144939220 ATGTTCTTTTTGCTTAAATTAGG + Intergenic
963462169 3:145629430-145629452 ATTTTATTTTTGGAGAAACTGGG - Intergenic
963677264 3:148327984-148328006 TTGTTGTTGTTGAAGAAACTAGG + Intergenic
965265696 3:166539529-166539551 TTGTTGTTGTTGTTAAAACTTGG - Intergenic
965274452 3:166663265-166663287 AGGATTTTTTTTCTGAAACTAGG - Intergenic
965910422 3:173768776-173768798 TTGTTGTTGTTGCTGAGACAGGG + Intronic
966026313 3:175287087-175287109 ATTTTGTTTTGTTTGAAACTAGG - Intronic
966174851 3:177126969-177126991 ATGTTGTTTTTGCTGAAACTGGG - Intronic
966479058 3:180384718-180384740 ATGTTCTTTTTTCTTAACCTGGG - Intergenic
967754249 3:193150567-193150589 AACTTGCTTTTGATGAAACTTGG + Intergenic
970056313 4:11977371-11977393 ATTTATTTTTTCCTGAAACTAGG + Intergenic
970671840 4:18405575-18405597 TTATTGTTCTTACTGAAACTTGG + Intergenic
970901880 4:21169165-21169187 TTGTTGTTGTTGCTGAGACAGGG + Intronic
971069191 4:23071561-23071583 ATATTCTTTTTGCTGAGAGTTGG + Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
971381057 4:26098076-26098098 ATTTTTTTGTTGTTGAAACTAGG - Intergenic
971439058 4:26660285-26660307 ATACTGTCTTTGGTGAAACTAGG + Intronic
972997056 4:44893406-44893428 CTGTTATATTTGCTGAAACTGGG - Intergenic
974313680 4:60247924-60247946 CTGTTGTTTCTGTTGAAGCTTGG + Intergenic
975186310 4:71407752-71407774 ATGTTGTATTTCCTCAAATTTGG - Intronic
975476234 4:74826541-74826563 ATAATGATTTTGCTGAAACAAGG - Intergenic
975655595 4:76638379-76638401 ATTTTTTTTTTGTTGAAACAGGG - Intronic
975957109 4:79854433-79854455 ATTTTGTTTTTCCTGGAAATAGG + Intergenic
975960457 4:79897737-79897759 ATGTTGCTTTGGATGAAACCAGG - Intergenic
976040934 4:80884539-80884561 ATTTTGTTTTTTCTGAATGTAGG - Intronic
976321716 4:83724434-83724456 ATGTTATTTTTACTGAACCAGGG + Intergenic
976732589 4:88279250-88279272 ATTATGTTTTTGTTAAAACTTGG - Intronic
976885893 4:89983821-89983843 TTTTTGTTGTTGCTGAGACTAGG - Intergenic
976948255 4:90797273-90797295 AGTCTGTTTTGGCTGAAACTAGG + Intronic
977781936 4:100991509-100991531 TTGTTGTTTTTGCTCAATATTGG - Intergenic
978035900 4:103994506-103994528 ATGTTTTTATTGCTTAAAATAGG + Intergenic
978328125 4:107581541-107581563 AGGCTGTTTTTTCAGAAACTAGG - Intergenic
978334764 4:107654632-107654654 ATGATGTTTGTGCTGAAATGTGG - Intronic
978379595 4:108112974-108112996 ATGTTGTTTTTCCTCCAACAGGG - Intronic
981779535 4:148411247-148411269 ATTTTGTTGTTGCTGTCACTTGG + Intronic
981961169 4:150540775-150540797 AAGTTGATTTTGCTGACACAGGG - Intronic
982073576 4:151717170-151717192 TTGTTGTTTTTGCTTTAAGTAGG - Intronic
983271460 4:165567251-165567273 ATGATGTTGGGGCTGAAACTCGG - Intergenic
983944309 4:173568718-173568740 ACGTTGTTTTTGCAGAGACAGGG - Intergenic
984071967 4:175126357-175126379 ATTTTTTTTTTGCAGAAGCTGGG + Intergenic
984505984 4:180619335-180619357 AAGTAGTATTTGCAGAAACTTGG + Intergenic
985772121 5:1818305-1818327 ATTGTGTTTTTTCTAAAACTTGG + Intergenic
988049883 5:26014154-26014176 ATGTTTATTTTGTTGAAACAAGG + Intergenic
988128256 5:27071990-27072012 TTGTTCTTTCTGCTCAAACTTGG + Intronic
988177766 5:27748999-27749021 TTGTTGTTTTTGCTTAGAATTGG - Intergenic
989305835 5:39954695-39954717 TTGTTCTTTTTGCTTAAAATTGG - Intergenic
990136812 5:52655076-52655098 AGGTTGCTCTGGCTGAAACTTGG + Intergenic
990621213 5:57561208-57561230 TGCTTGTTTTAGCTGAAACTTGG + Intergenic
990687756 5:58326225-58326247 ATGTTGATATTTCTGAAACATGG - Intergenic
990732373 5:58823345-58823367 AAATTGTTTTTGCAGAAACAGGG - Intronic
992283877 5:75212438-75212460 TTTTTGTTTTTGTAGAAACTGGG - Intronic
992401355 5:76414645-76414667 ATTTTGTTTTTGTAGAAACAAGG - Intronic
993128988 5:83872309-83872331 CTGTTGTGTTTCCTGGAACTTGG + Intergenic
993359271 5:86953785-86953807 CTTTTGTTTTTGCTCAAACTTGG - Intergenic
993547601 5:89231159-89231181 ATGTTAATTTTGCTGAGAGTTGG + Intergenic
994555227 5:101291049-101291071 GTGTTATTTTTGCTTAATCTTGG + Intergenic
994675017 5:102810432-102810454 AACTTGTTTTTGCTGAAATATGG + Intronic
994829491 5:104760615-104760637 TTGTTGTTTTTACTGAAAGCAGG - Intergenic
995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG + Intergenic
995428820 5:112051724-112051746 ATGGTTTTTTTTCTGAAATTAGG - Intergenic
995504338 5:112843406-112843428 ATGTTCCTTTTGCGGATACTTGG - Exonic
996764884 5:127026155-127026177 ATGCTGCTTTTCTTGAAACTGGG - Intronic
998707862 5:144784701-144784723 AATTTGGCTTTGCTGAAACTGGG - Intergenic
1000762833 5:165247587-165247609 TTGTTATGTTTGCTGCAACTTGG + Intergenic
1001183431 5:169542984-169543006 AGGTTGTTGTTGCTGAAGGTTGG - Intergenic
1003391539 6:5717429-5717451 CTGTTGTTTTTGAAGAAACTGGG + Intronic
1003485556 6:6574178-6574200 AGGTTGATTATGCTGAAATTTGG - Intergenic
1003666163 6:8113670-8113692 ATGTTCTCATTGCTGAAATTGGG - Intergenic
1004285591 6:14317911-14317933 ATGTTGTTTCTGATGAGCCTGGG - Intergenic
1004293318 6:14387958-14387980 GTTTTGCTTTTGCTAAAACTGGG + Intergenic
1006529346 6:34637891-34637913 TTGTTGTTGTTGTTGAAACTGGG + Intronic
1006894426 6:37458059-37458081 TTGTTGTTTTTGTTGAGACAGGG + Intronic
1007970395 6:46046319-46046341 CTGTTGATTTTACTGTAACTAGG - Intronic
1009699071 6:67151880-67151902 TTGTTTTTTTTTCTGAATCTAGG + Intergenic
1009724020 6:67512554-67512576 ATATTAGTTCTGCTGAAACTAGG - Intergenic
1010681063 6:78799722-78799744 ATATTGTTTTTTCTGACATTAGG + Intergenic
1011744609 6:90397378-90397400 ATGATCTTTTCGCTCAAACTAGG + Intergenic
1012098139 6:94992882-94992904 AGGTTTGTTTTGCTGAAAATAGG + Intergenic
1013485905 6:110595778-110595800 TTTTTGTTTGTTCTGAAACTGGG + Intergenic
1014934845 6:127375123-127375145 ATATTGTTTTTCCTCAAATTTGG + Intergenic
1015239269 6:131005819-131005841 ATGTTGTTTTCATTAAAACTGGG - Intronic
1015774654 6:136801328-136801350 ATTTTGTTTTCTTTGAAACTGGG - Intergenic
1016165734 6:140939868-140939890 ATGTTTATTTTGCTGAATCACGG + Intergenic
1017329618 6:153180657-153180679 ATGTTGCTTTGATTGAAACTGGG + Intergenic
1017332158 6:153212316-153212338 ATGATGTTTTTGCTGCAGCTTGG - Intergenic
1018710761 6:166496877-166496899 ATGTTGCCTTTGCTGACGCTGGG - Intronic
1018751638 6:166811615-166811637 ATTTTGTTTTTTCTGAGGCTAGG - Intronic
1019142704 6:169958013-169958035 GTTTTGTTTTTGGTGGAACTTGG + Intergenic
1020778433 7:12487250-12487272 ATGTTGTTATTCTAGAAACTTGG + Intergenic
1021337627 7:19422843-19422865 ATGTTATAATTGATGAAACTGGG + Intergenic
1022179407 7:27903917-27903939 AGCTTGTTTTTGCTGAAAAATGG - Intronic
1022771167 7:33474512-33474534 ATATTGTTTTTGCTTTAACCTGG + Intronic
1022966167 7:35474355-35474377 TTGTTGTTGTTGTTGAAAATTGG - Intergenic
1023250129 7:38250208-38250230 TTGTTGTTGTTGTTGAGACTGGG + Intergenic
1024285852 7:47756940-47756962 ATTTTATTTTACCTGAAACTTGG - Intronic
1025175094 7:56795681-56795703 ATGTTATTTTTGCAGAGACAGGG + Intergenic
1025696709 7:63780734-63780756 ATGTTATTTTTGCAGAGACAGGG - Intergenic
1026129266 7:67606776-67606798 ATGTTCTTATTTCTGAACCTGGG + Intergenic
1026630830 7:72036853-72036875 ATTTTTTTTTTGCTGAAAACTGG + Intronic
1026682467 7:72477592-72477614 TTGTTGTTTTTGTAGAAACGGGG + Intergenic
1028932262 7:96426639-96426661 CTGTTGTTTTTTCTTAAAATAGG - Intergenic
1030567745 7:111181127-111181149 ATATTGTTTTTGTTGCCACTAGG + Intronic
1031522409 7:122782602-122782624 TTGTTGTTGTTGCTGAGACAGGG - Intronic
1032208406 7:129889809-129889831 ATTTTGTTTTTGTGGAGACTGGG - Intronic
1032581588 7:133108037-133108059 ATGTTGCTATTTCTGAAACTGGG - Intergenic
1034094124 7:148390588-148390610 ATGTTTGTTTTGCAGGAACTTGG + Intronic
1035925057 8:3719267-3719289 GTGGCCTTTTTGCTGAAACTGGG - Intronic
1036993062 8:13621230-13621252 ATGTTGTTTTTCCTCACATTGGG - Intergenic
1037188235 8:16090699-16090721 ATGTTGTTTTTTCTCATAGTTGG - Intergenic
1037257662 8:16973289-16973311 ATTTTGTTTGCCCTGAAACTGGG - Intergenic
1037999712 8:23381293-23381315 ACATTGTTGTAGCTGAAACTTGG + Intronic
1038103929 8:24412372-24412394 ATGATGTTTTTGCAGCAACATGG + Intergenic
1038244026 8:25837541-25837563 ATTTATTTTTTGATGAAACTAGG + Intergenic
1038247818 8:25875372-25875394 AAGTTGCTTTTCCTGAAAGTTGG + Intronic
1038280644 8:26161156-26161178 TTGGTGTCTTTGCTGAAAATTGG - Intergenic
1038521525 8:28236339-28236361 ATGATTTTTTAGCTGAAACCTGG - Intergenic
1038878194 8:31575812-31575834 ATTTTGTTTTTGCTTTAAATTGG + Intergenic
1039080580 8:33730190-33730212 TTGTTGTTTTTGTTGAGACAAGG - Intergenic
1039343181 8:36673397-36673419 ATGTTGTTCTTGCTGTAAGCTGG + Intergenic
1039816866 8:41101903-41101925 ATTTTATTTTTTCTGAAACAGGG + Intergenic
1040486473 8:47877155-47877177 ATTTTGTTTTTGGAGATACTTGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041243607 8:55870606-55870628 TTGTATTTTTTGCAGAAACTGGG - Intergenic
1041949292 8:63482531-63482553 ATTTTGTTTTTAATGACACTTGG + Intergenic
1042156112 8:65845807-65845829 TTGTTGTTATTGCTGAAAATTGG + Intergenic
1044372803 8:91433228-91433250 TTGTTGTATCTGCAGAAACTAGG - Intergenic
1045022503 8:98056198-98056220 ATGTTATTTTTTCTGATGCTAGG + Intergenic
1046230533 8:111349672-111349694 TTCTTGTTGTTACTGAAACTTGG - Intergenic
1046436800 8:114200646-114200668 ACGTTGTTTTTGCTACAAGTGGG + Intergenic
1047831786 8:128640293-128640315 ATGTGTATTTTGCTGATACTGGG + Intergenic
1048018610 8:130519213-130519235 ATGGTGTTTTTGTGCAAACTAGG + Intergenic
1048065450 8:130963119-130963141 TTTTTTTTTTTTCTGAAACTTGG + Intronic
1048483790 8:134828970-134828992 ATTTTGATTTTGCTGAAGTTTGG + Intergenic
1049132527 8:140860479-140860501 ATTTTGTTTTTGTTGAGACAGGG + Intronic
1050310836 9:4351682-4351704 ATGTTGTTTTTCCTTGAACTAGG + Intergenic
1051627352 9:19110936-19110958 ATGTTTTTCTTGCTTAAACTGGG - Intronic
1052439027 9:28468870-28468892 ATGATATTTTTGTTGAAATTTGG - Intronic
1053508867 9:38669951-38669973 ATGTTCTTTTTCCAGAAAATGGG - Intergenic
1053535709 9:38923555-38923577 ATGCTGTTTTGGTTTAAACTAGG + Intergenic
1054207930 9:62147960-62147982 ATGCTGTTTTGGTTTAAACTAGG + Intergenic
1054630423 9:67440393-67440415 ATGCTGTTTTGGTTTAAACTAGG - Intergenic
1055070294 9:72159097-72159119 ATGTTGTTTTAGCACAAAGTAGG + Intronic
1055077937 9:72236542-72236564 TTGTTGTTTTTGCTGCAACAGGG - Intronic
1055787014 9:79881983-79882005 AAGTTGTCTTTTCTCAAACTGGG + Intergenic
1055875140 9:80933108-80933130 TTGTTCTGCTTGCTGAAACTTGG + Intergenic
1055938592 9:81626936-81626958 ATTTTGTTTTTGCTGTGATTAGG - Intronic
1056693719 9:88828897-88828919 CCCTTGTTCTTGCTGAAACTGGG + Intergenic
1058290634 9:103236582-103236604 CTGTTGTTTATGCGGAAACAAGG - Intergenic
1058795703 9:108496364-108496386 ATTTTGTATTTGCTGAAATTGGG + Intergenic
1060288084 9:122272713-122272735 ATGATGTTTTTGTTGAACATGGG + Intronic
1061652726 9:132064067-132064089 ATGTTGTTTGTGATGAGAATTGG - Intronic
1188251935 X:27907113-27907135 ACCATGTTTTTTCTGAAACTCGG + Intergenic
1188595626 X:31896871-31896893 ATGTTGTTCTATCAGAAACTCGG - Intronic
1188810202 X:34644447-34644469 ATTTTGTCTTTTCTGAAAATTGG - Intronic
1188958234 X:36460157-36460179 ATGTTTTTTTTGCAGCAACATGG + Intergenic
1189013320 X:37069999-37070021 ATGCTGTTTTGCCTGGAACTTGG + Intergenic
1189237600 X:39499710-39499732 ATAATGTTTTTGCAGCAACTTGG - Intergenic
1189575433 X:42347811-42347833 ATTTTGTTTTTCCTGGAATTTGG + Intergenic
1189864709 X:45314521-45314543 TTGTTCTTTTTGCTTAAAATTGG - Intergenic
1193482916 X:82049118-82049140 ATGTATTTTTTTCTGAAATTAGG - Intergenic
1193769282 X:85569490-85569512 AACTTGTTTTAGGTGAAACTTGG + Intergenic
1194505335 X:94727184-94727206 ATCCTGGTTTTTCTGAAACTGGG - Intergenic
1195048375 X:101075481-101075503 ATGTTGTTTTTAATAAAAATGGG + Intergenic
1195114059 X:101678177-101678199 ATGATTATTTTGTTGAAACTGGG + Intergenic
1195627179 X:107016293-107016315 ATGTTGTAATTTTTGAAACTAGG + Intergenic
1195818378 X:108914230-108914252 TTGTTCTTTTTGCTTAATCTTGG - Intergenic
1196041734 X:111211979-111212001 CTGTTGTCTTTGCTTAAAGTCGG - Intronic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1196551644 X:117033811-117033833 ATGTTATTTTTTCTAAAACATGG - Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1197931617 X:131702141-131702163 ATGATGTATTTGCAGCAACTTGG + Intergenic
1198792836 X:140364392-140364414 ATGTGGTTAATTCTGAAACTTGG - Intergenic
1202592085 Y:26495662-26495684 GTATTGTTTTTCCTGAAACCTGG + Intergenic