ID: 966175081

View in Genome Browser
Species Human (GRCh38)
Location 3:177129847-177129869
Sequence AAAAATGCACATATCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 531}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966175077_966175081 8 Left 966175077 3:177129816-177129838 CCTCCATGAAGACAACCTGGCAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG 0: 1
1: 0
2: 6
3: 49
4: 531
966175078_966175081 5 Left 966175078 3:177129819-177129841 CCATGAAGACAACCTGGCAGTGA 0: 1
1: 0
2: 0
3: 12
4: 184
Right 966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG 0: 1
1: 0
2: 6
3: 49
4: 531
966175079_966175081 -7 Left 966175079 3:177129831-177129853 CCTGGCAGTGAAATTTAAAAATG 0: 1
1: 0
2: 4
3: 35
4: 424
Right 966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG 0: 1
1: 0
2: 6
3: 49
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966175081 Original CRISPR AAAAATGCACATATCCAGCA GGG Intronic
901122858 1:6909446-6909468 GAAAAGGCCCATCTCCAGCAGGG + Intronic
902114508 1:14110136-14110158 AAAAATGCATTTAGTCAGCAGGG + Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
902309512 1:15570499-15570521 AAAAATGAACAAATCTGGCATGG - Exonic
902419187 1:16264334-16264356 AAAAAGGCACATAACCACTATGG + Intronic
903471489 1:23590777-23590799 AAAAGTGGACATTTCTAGCAAGG + Intronic
904672420 1:32175800-32175822 AAAAATCCACATCTTCAGCTGGG + Exonic
906446039 1:45898925-45898947 AAGAATGCCCATATGGAGCATGG - Intronic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
906900422 1:49829975-49829997 AAATGTGCACATATACACCATGG - Intronic
908245578 1:62225213-62225235 AAAAATACAAAAATCCATCATGG - Intergenic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
910250410 1:85192196-85192218 AAAAATCCAAATGTCCAGCCTGG + Intronic
911136111 1:94442826-94442848 AAAAATGTACATATATACCATGG - Intronic
911341871 1:96649287-96649309 AACAATGCACATTTCCAAAATGG + Intergenic
911810060 1:102264848-102264870 AAAATGGCACATATACACCATGG + Intergenic
911831250 1:102553665-102553687 AATAATGCAGGTACCCAGCAAGG + Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912626483 1:111208974-111208996 ATATATCCATATATCCAGCAAGG - Intronic
913472229 1:119200613-119200635 AAAAATGGACATATAAACCAGGG + Intergenic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
914888845 1:151605078-151605100 AAAAAGCAACATACCCAGCAAGG - Intergenic
915387866 1:155512745-155512767 AAAAAAACACATATCAAGCTGGG + Intronic
915533875 1:156522198-156522220 ATAAGTGCACATACCCAGCAAGG - Intergenic
915773550 1:158456270-158456292 AAAAATGTATATATACACCATGG + Intergenic
916456189 1:164973045-164973067 AAAAATGCACATATCGGCCGAGG - Intergenic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
917027174 1:170657167-170657189 ATAAATGTGCAGATCCAGCAAGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917712333 1:177698292-177698314 AATATGGCACATATACAGCATGG + Intergenic
918135310 1:181668389-181668411 AAAAATTCACATGTCCTCCAAGG - Intronic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919255166 1:195111429-195111451 AAAATGGCACATATACAACATGG + Intergenic
920290585 1:204920411-204920433 AAAAAAGGACAGATCCTGCAAGG - Intronic
921267126 1:213430252-213430274 GAAACTGCCCATTTCCAGCATGG + Intergenic
921769508 1:219019553-219019575 AAAAATGAACTGATCCAGTATGG + Intergenic
923000239 1:230001188-230001210 CAAAATGAACATAACCAGAATGG + Intergenic
923092585 1:230751351-230751373 GAAAAGCCACATTTCCAGCAAGG - Intronic
923918956 1:238542282-238542304 AAATATGCACATATTCAAAAAGG + Intergenic
924025273 1:239825864-239825886 AACACTGCACCTGTCCAGCAAGG + Intronic
924646922 1:245886715-245886737 AAAAATTCAAATATCGGGCAAGG - Intronic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063801586 10:9585038-9585060 AAATGTGCACATATACACCATGG + Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1064207345 10:13335373-13335395 AAAAATGCACAGGTCGGGCACGG + Intronic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1065146433 10:22772832-22772854 AAAAATGTACATATACACCATGG - Intergenic
1065428510 10:25630463-25630485 CAAAATGCACAAAGCAAGCAAGG - Intergenic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1066236109 10:33486254-33486276 AAAAATGAACAAATACAGGAAGG - Intergenic
1067517885 10:46969465-46969487 AAACAAGTACATATCCAACATGG + Intronic
1067595934 10:47557354-47557376 AAAAATTCAGACATTCAGCATGG - Intergenic
1067644363 10:48082364-48082386 AAACAAGTACATATCCAACATGG - Intergenic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068638658 10:59376601-59376623 AGAAATGCACATATGGAGCCTGG + Intergenic
1068826485 10:61445810-61445832 AAAAATTCACATTTACATCAAGG - Intronic
1069320898 10:67170400-67170422 AACAAGGCACATATTCACCATGG + Intronic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1069751211 10:70746350-70746372 AAAAATGGACATGTCCAGAGAGG + Intronic
1069875289 10:71559252-71559274 AAAAATGCACAAATCCACAAGGG - Intronic
1070040259 10:72771399-72771421 AAATGTGCACATATACACCATGG - Intronic
1070388541 10:75948840-75948862 AAATTTCCCCATATCCAGCAAGG - Intronic
1070531394 10:77340494-77340516 AAATGTGCACATATACACCATGG + Intronic
1071617063 10:87084996-87085018 AAAAATTCAGACATTCAGCATGG + Intronic
1073769967 10:106725388-106725410 AAAAATGCAAAAAACCAGCTGGG + Intronic
1073822048 10:107275122-107275144 CAAAATGCACAAACCAAGCAAGG + Intergenic
1074009578 10:109463644-109463666 CCAAATGTACATAGCCAGCAAGG + Intergenic
1074124419 10:110516768-110516790 AAAAATGCACAGATACTTCAAGG - Intergenic
1074229727 10:111522077-111522099 AACAATGTCCATATCCAGTATGG + Intergenic
1074271129 10:111954893-111954915 AAAAATGGACATTTCCTTCATGG - Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074683323 10:115933404-115933426 CCAAATGCACATTTCTAGCAAGG + Intronic
1075012288 10:118884959-118884981 AATAATGCACATGTCCAGGCCGG + Intergenic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1076065186 10:127442832-127442854 AGACATGCAGATAGCCAGCAAGG - Intronic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078115999 11:8451324-8451346 AAAAATCCACATGTGCATCAGGG + Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1078801825 11:14653374-14653396 AAAAATCCACAAATCAGGCAAGG + Intronic
1079576919 11:22015686-22015708 AATAAGGCACATATACACCATGG - Intergenic
1079999509 11:27331714-27331736 AAAAATGTACAAATCCACAAGGG + Intronic
1081240269 11:40697148-40697170 AAAAATGTATATATGCAGTATGG - Intronic
1081704219 11:45171393-45171415 AAAAATCCACATAACCGGCTGGG - Intronic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1082938112 11:58675397-58675419 AAAAATGCAAATATGCATGAGGG - Intronic
1083366410 11:62144034-62144056 AAAAATGAACATAGCCAGCTGGG + Intronic
1084217656 11:67658922-67658944 AAAAACCCACATATCCTGTAGGG - Intergenic
1085168228 11:74424026-74424048 AAAAATACACAAAACCAGCCAGG - Intergenic
1085594697 11:77798618-77798640 AAAAAGGCACATATACACCATGG + Intronic
1086130594 11:83397689-83397711 AAAAATACAAAAATACAGCAGGG - Intergenic
1086233065 11:84593426-84593448 AAATGTGCACATATACACCATGG + Intronic
1086800072 11:91162343-91162365 AATATGGCACATATACAGCATGG + Intergenic
1086823588 11:91467519-91467541 AAAAATGCAAATAGCTAGCCGGG - Intergenic
1087153420 11:94878956-94878978 AAAAAGTCACATTTCCAACAAGG - Intergenic
1087422653 11:97949769-97949791 AAATTTGCACATATACACCATGG - Intergenic
1088025156 11:105170878-105170900 AAAAATGTACATATACACCATGG - Intergenic
1088112901 11:106282359-106282381 CAAAATTCAAATATACAGCAGGG + Intergenic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1089690583 11:120184602-120184624 AAAAATGCACTCATCCCCCAAGG + Intronic
1091208816 11:133839314-133839336 AATGAGGCACATATCCACCATGG + Intergenic
1092299219 12:7229291-7229313 AAACATTCAAATAGCCAGCATGG + Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1093123765 12:15304131-15304153 AAAATGGCACATATACATCATGG + Intronic
1093437795 12:19156752-19156774 AAAACTGTACAGGTCCAGCACGG + Intronic
1093872255 12:24306578-24306600 AAAGAAGCCCACATCCAGCAAGG + Intergenic
1093947367 12:25124980-25125002 GAAAATGTACATACCCACCATGG - Intronic
1094430275 12:30360625-30360647 AAAAATTCACAGATCTGGCAGGG - Intergenic
1094790829 12:33912923-33912945 AAATGTGCACATATACACCATGG - Intergenic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1095546098 12:43372118-43372140 CCAAATGCACATTTCCAGCTTGG - Intronic
1096059584 12:48685466-48685488 CCAAATGCATATATCCAGCCTGG + Intergenic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097600682 12:61688691-61688713 AAAAATGTACATATACACCATGG - Intergenic
1097692829 12:62749298-62749320 TAAACTGCACATTTCCAGAATGG + Intronic
1097729047 12:63106892-63106914 AAAAATGAACATTTTCAGGAAGG - Intergenic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1097766867 12:63536013-63536035 AAAAATTCATATAGACAGCAGGG - Intergenic
1097783214 12:63730944-63730966 AAAAATTCATATAGACAGCAGGG - Intergenic
1097897715 12:64842196-64842218 AAAAATACAAAAAACCAGCAGGG + Intronic
1098634967 12:72771709-72771731 AAAAATTCATATATCTAGCTTGG - Intergenic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1099158662 12:79211798-79211820 AGAAAGGCACATATACACCATGG - Intronic
1100768235 12:97892671-97892693 AATATGGCACATATCCACCATGG - Intergenic
1102373806 12:112404627-112404649 TAAAATGCACAAATCTGGCAGGG + Intergenic
1102713159 12:114946198-114946220 AAAAATACAGAGATCAAGCAGGG + Intergenic
1102814563 12:115854038-115854060 AAAAATGTACATATACACTATGG - Intergenic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1103997584 12:124840168-124840190 AAAAATGCAGATAGCCAACGGGG - Intronic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1106211926 13:27657232-27657254 AAAAATACAGATCTCCAGCCAGG + Intronic
1107328448 13:39270995-39271017 AAAAATGCATATATTCAACTTGG + Intergenic
1107463943 13:40631974-40631996 AAAAATGAAAAAACCCAGCAGGG + Intronic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109801594 13:67386011-67386033 GAAAATGTACATATTCACCATGG - Intergenic
1109943444 13:69401708-69401730 AAAAATATAAATATGCAGCAAGG + Intergenic
1109995580 13:70120704-70120726 AAATCTGCACATATACACCATGG + Intergenic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1110697219 13:78504872-78504894 AAAAATACACATATACGGCTGGG - Intergenic
1111090907 13:83445934-83445956 AATAATTCAAATATCCATCAGGG + Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1112380579 13:98885305-98885327 AAAAATGTACATATGCAGGCTGG + Intronic
1112499277 13:99930014-99930036 AAGAATGCAGACATGCAGCATGG + Intergenic
1112667990 13:101598793-101598815 AATATGGCACATATACAGCATGG - Intronic
1112798327 13:103082251-103082273 TAAAAGGCACAGATCCAGAAAGG + Intergenic
1112824465 13:103375968-103375990 GAAAATGTACATATACGGCATGG + Intergenic
1113223579 13:108133837-108133859 AGAAACGCACTTAGCCAGCAAGG - Intergenic
1113966869 13:114157611-114157633 AATAAGGCACATATACACCATGG + Intergenic
1114422400 14:22595716-22595738 AAAAATACAATTATCCAGCCTGG - Intergenic
1114807967 14:25859519-25859541 AAAAATGCACCTGTCAAGGAAGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115273522 14:31580901-31580923 AAAAATCCAAATTTCCACCACGG - Intronic
1115876727 14:37869626-37869648 AAAAATGCACATCCCCTTCAAGG - Intronic
1115912303 14:38269916-38269938 AAAAATGTACATATACACCATGG + Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1117698541 14:58390872-58390894 AAACCTGCACACATCCAGCATGG + Intergenic
1117847108 14:59922904-59922926 AAAATTTCACCTAACCAGCATGG - Intronic
1118005047 14:61558175-61558197 AAAAATGAACTTTTCCACCAAGG + Intronic
1118817296 14:69322503-69322525 AAAAATGTACATAGCCCCCAGGG - Intronic
1118965430 14:70579047-70579069 AAAAATGTACCTATACACCATGG - Intergenic
1119219444 14:72894021-72894043 AAAAATGTACATATTCCGCGTGG - Intronic
1119464593 14:74845812-74845834 AAAAATGCATACATACAGAAAGG - Intronic
1119696203 14:76715199-76715221 AAAAATGCACACATCTGGCTGGG - Intergenic
1120564832 14:86042696-86042718 AATACGGCACATATACAGCATGG - Intergenic
1121593736 14:95142045-95142067 AGATATGCTCATATACAGCATGG - Intronic
1122398984 14:101456315-101456337 CAAAATCCACAAATCCAACAGGG + Intergenic
1123755936 15:23397757-23397779 AAGAATGCGCATTTCTAGCAAGG - Intergenic
1123902455 15:24890379-24890401 AAAAATACACCTATCCAGCTGGG + Intronic
1123998919 15:25738342-25738364 TAAAAAGCAGATATCCAGCTAGG + Intronic
1124194656 15:27611444-27611466 ACAAATGCCAATGTCCAGCAGGG + Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1125976109 15:43953251-43953273 AAAACTGCACAGATTCTGCAAGG + Intronic
1126266321 15:46757802-46757824 AAAATTTCACCTATGCAGCATGG - Intergenic
1127120449 15:55767420-55767442 AAGACTGCAGATATTCAGCATGG - Intergenic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127567911 15:60211442-60211464 AAAATTGCACATATCGGGCCGGG - Intergenic
1127742662 15:61927825-61927847 AAAATGGCACATATACACCATGG + Intronic
1127875286 15:63106608-63106630 AAAAATACAAAAATCCAGCCGGG - Intergenic
1128745714 15:70112767-70112789 AAAATGGCACATATACACCATGG - Intergenic
1128759086 15:70203207-70203229 AAAAATGCACTTTTTCAGCTGGG - Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1129559275 15:76549389-76549411 AAATATGCACATATACACCATGG + Intronic
1130343977 15:83024758-83024780 AAAAATTCAAAAATTCAGCATGG - Intronic
1130439432 15:83937290-83937312 AAAAATGTACATATACACCATGG + Intronic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1131030325 15:89180806-89180828 AATAATCCACATGTCCAGCATGG + Intronic
1131284556 15:91046273-91046295 AATATGGCACATATACAGCATGG - Intergenic
1131362929 15:91810199-91810221 AAAAATGTAAATATGCAGAATGG + Intergenic
1132183656 15:99783165-99783187 AAAAATGCAAAAAACTAGCAGGG + Intergenic
1132308426 15:100836094-100836116 ACAAATGCACACATACAACATGG + Intergenic
1133687549 16:8180372-8180394 AAAAATGAATATATACAGAAGGG + Intergenic
1134460396 16:14424961-14424983 AAGAATGCACATTTCTAGCAAGG + Intergenic
1135148049 16:19980298-19980320 AAAAATGCAGATTTCCAGCATGG + Intergenic
1135790049 16:25385603-25385625 AAATATGCACATATACTCCATGG - Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1136187018 16:28594299-28594321 AAAGATGCAAATAATCAGCAGGG - Intronic
1137376283 16:47954880-47954902 ACCAATTCACATATCCACCAAGG - Intergenic
1139381022 16:66531016-66531038 AGAAATGCACATTTTCAGCTGGG - Intronic
1139970115 16:70769109-70769131 AAAAATGCACATCCACAGCTGGG - Intronic
1140200111 16:72888237-72888259 AAAACTGCACACATCCATGATGG + Intronic
1140548555 16:75837039-75837061 GAAAAAGGACATATCCAGCAAGG - Intergenic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1140772451 16:78217258-78217280 ATAACTCCACATATCCTGCAAGG - Intronic
1141075299 16:81000977-81000999 AAATATGTACATATACACCATGG + Intronic
1143439764 17:6960629-6960651 AAAATGGCACATATACACCACGG + Intronic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1144247488 17:13381895-13381917 AAAAATGCAAATATTTAGCCAGG - Intergenic
1144748170 17:17629782-17629804 AAAAATGCAAAAATTTAGCAGGG - Intergenic
1146144986 17:30407174-30407196 AAATGTGCACATATACACCATGG - Intronic
1147575522 17:41596725-41596747 AAAACTAAAAATATCCAGCAAGG + Intergenic
1148121066 17:45211700-45211722 ACAAAGGCACAAATCCAGAAAGG - Intergenic
1149015168 17:51900701-51900723 AAAAATGAACAAAACCACCAAGG - Intronic
1150319418 17:64199530-64199552 AAAATTACACATTTTCAGCAAGG - Intronic
1150614612 17:66760003-66760025 AGAAATAGACATATCCCGCAAGG + Intronic
1150702036 17:67455735-67455757 AAAAATGTAGATACCCAGCTGGG - Intronic
1150909317 17:69371585-69371607 AAAAATGAAAACATCAAGCAGGG + Intergenic
1150986027 17:70197943-70197965 AAAAATGTCCATACCAAGCATGG - Intergenic
1151898834 17:76998294-76998316 CCAAATGCACATCCCCAGCAAGG + Intergenic
1153740085 18:8115789-8115811 GAAAATGCACATGTACATCATGG - Intronic
1153987059 18:10361276-10361298 AAAAATGAACATTTCCAAAACGG - Intergenic
1154257483 18:12796132-12796154 AAAAATACAAATGTCAAGCAAGG + Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1156569257 18:38234105-38234127 AGAAATGAACACTTCCAGCAAGG - Intergenic
1157001822 18:43536415-43536437 AAAAATACAAAAATTCAGCATGG + Intergenic
1157019516 18:43762683-43762705 AAAAATACACATATCCTGGCCGG + Intergenic
1157670986 18:49528452-49528474 AAATATGCACATATACATAATGG - Intergenic
1158774051 18:60555461-60555483 AAGCATGCACATACCCAGCCAGG - Intergenic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1159610182 18:70516007-70516029 AAATGTGCACATATACACCATGG - Intergenic
1160536394 18:79596727-79596749 ACAAATGCACGTCTCCAGCCTGG + Intergenic
1161011677 19:1962342-1962364 AAAAAAGCACACCCCCAGCATGG + Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162245511 19:9396659-9396681 ACAAATGGACAGATCCAGCAGGG + Intergenic
1164064306 19:21702087-21702109 AAAAATACAAAAATCAAGCATGG + Intergenic
1167992824 19:53375074-53375096 AAAATTGCACCAATCCAGCCAGG - Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925745541 2:7040308-7040330 TAAAATGCACATTTCAAGAAAGG - Exonic
925883340 2:8370800-8370822 AAACAAGCACATTTCCTGCAAGG + Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
928734209 2:34266979-34267001 AAAGATTCAGATAACCAGCAAGG - Intergenic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
930359852 2:50363873-50363895 AAATGTGCACATATACACCATGG + Intronic
930439194 2:51385375-51385397 AAATATGCACATAACAAGGAGGG + Intergenic
930759367 2:55016285-55016307 AAAAATACACATATGCGGCCAGG + Intronic
930890321 2:56377725-56377747 AAAAATACAAAAATTCAGCAGGG + Intronic
930966272 2:57332097-57332119 AAAAATGCAAATATAAAGCCAGG + Intergenic
931784793 2:65609057-65609079 AAAAATGAAAATAGCCAGCAAGG - Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
932978895 2:76639095-76639117 AAAAATGCAAATTTCCTGCCTGG - Intergenic
933006274 2:76999405-76999427 AAAAATGCTTAAATCCAGGAAGG + Intronic
933793290 2:85900766-85900788 AACAATTCAAATATCCACCAAGG - Intergenic
934750509 2:96790822-96790844 AAAAATACAAAAATCCAGCTGGG + Intronic
935020796 2:99229188-99229210 AAAATGGCACATATACACCATGG + Intronic
935152118 2:100447238-100447260 ATAACTGCACATAGACAGCATGG + Intergenic
935301740 2:101698406-101698428 AAAAATGAATAAATCAAGCAAGG - Intronic
935719002 2:105963088-105963110 AAAAATCCATATATTCAACATGG + Intergenic
936066102 2:109333296-109333318 AGCAATGAATATATCCAGCAAGG - Intronic
936473376 2:112818590-112818612 AAAAATGCAGGGATCCAGCCTGG + Intergenic
936499238 2:113052719-113052741 AAAAATGCATGTAGCTAGCATGG - Intronic
936582529 2:113715563-113715585 AAACCTACCCATATCCAGCAAGG - Intronic
936583398 2:113727369-113727391 AAAAGAACACATATACAGCAAGG + Intronic
936772400 2:115930054-115930076 AGAAATGAACAGATCCAGCAAGG - Intergenic
937446747 2:121964870-121964892 AAAAATGTACATATACATCATGG + Intergenic
938883181 2:135613519-135613541 ACAAATGCATAAATCCAGCAGGG + Intronic
939040382 2:137182047-137182069 GAAAATTCACTTATCCAGAAGGG + Intronic
939543028 2:143516906-143516928 AAAAATGCACATTTCCATATTGG + Intronic
939974107 2:148696387-148696409 ATAAATGCACATAGCCTGAAGGG - Intronic
940535019 2:154930382-154930404 AAAAATTTAGATATCCAGTATGG + Intergenic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
942134827 2:172914492-172914514 TAAAATGCATATTTCCGGCAGGG - Intronic
943040509 2:182798956-182798978 AAAAATGCACATATTCAGTATGG + Intergenic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
943399131 2:187383041-187383063 AAAACTGCACATATACAAAAAGG + Intronic
944205363 2:197152520-197152542 AAAGATACACACAGCCAGCAGGG + Intronic
945312001 2:208324671-208324693 AAAAATGCACTTAAGCATCATGG - Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945590287 2:211720571-211720593 AAACAGGCAAAGATCCAGCACGG - Intronic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
946015415 2:216600264-216600286 AAAAAGGAACATAGCAAGCAAGG - Intergenic
947608216 2:231504225-231504247 TAAAATTCACATAACCAGCCGGG + Intergenic
947925312 2:233916185-233916207 AAAAACTCCCATACCCAGCATGG - Intergenic
947997576 2:234541819-234541841 AAAAATACACAAAACTAGCAGGG - Intergenic
948226791 2:236317683-236317705 AAAAATGTAAATATCCATGAGGG - Intergenic
1170841829 20:19930122-19930144 AAAAGTCCCCACATCCAGCAGGG + Intronic
1170919939 20:20668533-20668555 AAAAATGCACATAAAAAACATGG + Intronic
1171196818 20:23206293-23206315 AAGAATGCGCATTTCCAACAAGG + Intergenic
1171353686 20:24525720-24525742 AAAAATGCACATATAAAACTTGG - Intronic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1173035941 20:39410429-39410451 AAAGTTGCACATATACACCATGG + Intergenic
1173650474 20:44660720-44660742 TAACATGCACATGTCCAGGAGGG - Intergenic
1174004488 20:47399711-47399733 ACAAATACACATATACAGCCAGG - Intergenic
1174498545 20:50967085-50967107 AAAAATGCACAAATCCTGGCTGG + Intergenic
1174946143 20:54987876-54987898 CAAAATTAACATATACAGCATGG - Intergenic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1176846775 21:13882617-13882639 AAAGATGCACATGTACAGCTTGG - Intergenic
1180212558 21:46303424-46303446 CAAAATGCACATATCAAAAAAGG + Intronic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
1183274488 22:36884658-36884680 TAAAATGCACATATCCCCCAAGG - Intergenic
1184384259 22:44165396-44165418 ATCAAAGCACATGTCCAGCAGGG + Intronic
1184410896 22:44325747-44325769 AAAAAGCCACATGTCCAGCCAGG + Intergenic
1184463106 22:44651314-44651336 AAAAATACACATTGCCAGCCAGG + Intergenic
949221837 3:1643831-1643853 AAAAATGTACTTACCAAGCATGG - Intergenic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
949624809 3:5853601-5853623 AAAATTGCAAATGGCCAGCAAGG - Intergenic
951424920 3:22533186-22533208 AAATGTGCACATATACACCATGG + Intergenic
951613386 3:24517361-24517383 AAATATGACCATATCCAGCTTGG - Intergenic
951800736 3:26593187-26593209 TAAAATGAATATATACAGCATGG - Intergenic
952659456 3:35827744-35827766 AAAAAGGCACATATACGCCATGG + Intergenic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
953329555 3:42041473-42041495 ACAAATACACAAATTCAGCAAGG - Intronic
953951459 3:47193585-47193607 AAAAATGCACATTTCAGGCCGGG - Intergenic
954234733 3:49247627-49247649 AAAAATAAACAAAACCAGCAGGG + Intronic
954826805 3:53380688-53380710 AAAAATGGACATTTCCAGCTGGG + Intergenic
955821394 3:62899647-62899669 ATAAATGTACATATCCTGTAGGG - Intergenic
956001230 3:64732039-64732061 AAAATGGCACATATACATCAGGG + Intergenic
956350746 3:68333276-68333298 GAAAATGCAAATATACACCATGG + Intronic
956485630 3:69719168-69719190 AAAAAGGCACATGACTAGCAAGG + Intergenic
957380415 3:79421004-79421026 CAAAATGTACATATACACCATGG + Intronic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
957622188 3:82607948-82607970 ACAAATACACATATACACCATGG + Intergenic
957879131 3:86187563-86187585 AATACTGCACATATACACCATGG + Intergenic
957947106 3:87079086-87079108 AAAAATGCACATACTAAGAATGG + Intergenic
958675646 3:97265461-97265483 AAGCAGGCACATATCCGGCAGGG + Intronic
959347496 3:105217518-105217540 AATAAGGCACATATACACCATGG - Intergenic
961334626 3:126164581-126164603 TAAAATGTACATATACACCATGG - Intronic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
961871835 3:129994014-129994036 ACAAATGCAGAACTCCAGCATGG - Intergenic
962418212 3:135203001-135203023 AAAATGGCACATATACACCATGG + Intronic
962783363 3:138742707-138742729 AAAAATGCGCAAATTCAGCGAGG - Exonic
963863919 3:150340136-150340158 AAAAATGAGCAAATCCAGAAGGG - Intergenic
964170635 3:153766348-153766370 AAATGTGCACATATACACCATGG + Intergenic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
966664220 3:182452453-182452475 AAAAATTGACGTATTCAGCAGGG + Intergenic
967195679 3:187023518-187023540 AAATGTGCACATATACACCATGG + Intronic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
968937578 4:3620268-3620290 CAAAATGCACAAACCAAGCAAGG + Intergenic
970077134 4:12235836-12235858 AAAAATGCACATACTTATCAAGG + Intergenic
970754132 4:19403517-19403539 ACAAATGCATGTATCAAGCAAGG - Intergenic
971296637 4:25399740-25399762 CCAAATGCACATTTCCAGCCTGG - Intronic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972982101 4:44717196-44717218 AATAATGCACATATCCTTGACGG - Exonic
973064575 4:45772844-45772866 GAAAATGCACATATACCCCATGG - Intergenic
973079539 4:45972495-45972517 AAAGTGGCACATATCCACCAAGG + Intergenic
973807521 4:54540274-54540296 AAAAATACACATTTCCGGCCGGG + Intergenic
974548190 4:63339351-63339373 AAATGTGCACATATACACCATGG + Intergenic
975148119 4:70992717-70992739 AAAAATGCACTCATCTAGCTGGG + Intronic
975302974 4:72813175-72813197 AAACAGGCACATATACATCATGG + Intergenic
975552355 4:75626677-75626699 AAAAAAGCACAATTCCAGCCTGG + Intronic
975594220 4:76032500-76032522 AAAAATTCACATAGTCAGCTGGG - Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
977159431 4:93614747-93614769 ACAAATGTAAATATCCAGCACGG - Intronic
977384181 4:96317637-96317659 ATAAATGCATATTTCCAGAATGG - Intergenic
977458308 4:97291952-97291974 AAAAATGTACATATACACAATGG - Intronic
978276296 4:106954814-106954836 AAAAATGAACATTTCTAGCCGGG - Intronic
978867135 4:113526854-113526876 CAAAATGCCCAGATCCTGCATGG - Intronic
979742880 4:124173427-124173449 AAACATGTACATATACACCATGG + Intergenic
980312250 4:131146657-131146679 AAAATGGCACATATACACCATGG - Intergenic
980710150 4:136555623-136555645 ACAAATTCACACATCCACCAAGG - Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
981221680 4:142244270-142244292 AAAAAGGCACATATACACCATGG - Intronic
981470499 4:145128907-145128929 AAAAATTCAAATATACAGAATGG + Exonic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982250396 4:153400355-153400377 TAAAATGCACAAAGCCAGGAAGG - Intronic
982610987 4:157574578-157574600 AAGCATGCACATACCCAGCCGGG - Intergenic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
984358899 4:178702240-178702262 AAATGTGCACATATACACCATGG - Intergenic
984359421 4:178709836-178709858 AAATGTGCACATATACACCATGG + Intergenic
984636379 4:182114884-182114906 CAAAATCCACAAATCCAGCCAGG + Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986300423 5:6474366-6474388 AAAAATTCCCAGAGCCAGCAGGG + Intronic
987477346 5:18407654-18407676 AAAAAAACAAATATCCATCATGG + Intergenic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989340955 5:40375159-40375181 AAAAATGCACATAAATAGCACGG + Intergenic
989404107 5:41041329-41041351 AAAAATACACATCTTCAGCGGGG + Intronic
989605615 5:43241631-43241653 AAAAATACCAATATCCAGCCAGG - Intronic
989652318 5:43706753-43706775 AAATGTGCACATATACACCATGG + Exonic
989839076 5:46037399-46037421 AAGAATGCACATATCCAAAGTGG - Intergenic
989969677 5:50507853-50507875 AAATATGTACATATACACCATGG + Intergenic
990115034 5:52379556-52379578 AATGAGGCACATATACAGCATGG - Intergenic
990161065 5:52941138-52941160 AAATATGTACATATACACCATGG - Intronic
991316000 5:65307590-65307612 TACAATTCACATATACAGCAAGG + Intronic
992900956 5:81294886-81294908 AAATATGTACATATACACCATGG + Intergenic
993083017 5:83325668-83325690 AAATATGTACATATACACCATGG - Intronic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
993536323 5:89091339-89091361 ACTAATGCACATACCTAGCATGG - Intergenic
993794981 5:92255808-92255830 AAAAATGCACATATACACCATGG - Intergenic
993942329 5:94074684-94074706 AACATGGCACAAATCCAGCAGGG - Exonic
993960410 5:94290492-94290514 AAATATGGACATATACACCATGG - Intronic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994472559 5:100226767-100226789 AAAAATGTACATATACACCATGG - Intergenic
995117517 5:108498641-108498663 AAAAATGTATATATACACCATGG - Intergenic
995562532 5:113398461-113398483 GAAAATGCACATATATACCATGG + Intronic
996149576 5:120019042-120019064 AAAAATACATATATCCAACTGGG - Intergenic
997659877 5:135581258-135581280 AACAATCCAAATGTCCAGCAAGG - Intergenic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
999565017 5:152849572-152849594 AGAAATGGACAGATCTAGCAGGG - Intergenic
1000235718 5:159358251-159358273 TAAAATGCAAATATCCTTCATGG + Intergenic
1000685490 5:164243954-164243976 AACAATGCACGTATCCAACTAGG - Intergenic
1001369107 5:171178379-171178401 AAATGTGCACATATACACCATGG - Intronic
1003581773 6:7347026-7347048 AAAAATGTAAATATTCTGCAGGG - Intronic
1003748411 6:9027896-9027918 ACCAATGCACAGATCCAGGAAGG + Intergenic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1004688893 6:17975046-17975068 AGAAATGCACATTCCCAGCTGGG + Intronic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1005773772 6:29106122-29106144 GAAAATTCACATATACAACATGG - Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1006470455 6:34225869-34225891 GAAAATGCCCTTATTCAGCAAGG - Intergenic
1006982685 6:38158486-38158508 AAAAATGCCCATCTCCAGCCAGG - Intergenic
1007350559 6:41270512-41270534 AATAAGGCAAATATCCATCATGG + Intronic
1007830323 6:44633487-44633509 AGAAATACACATATCCATAAAGG - Intergenic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1008724679 6:54402241-54402263 AACAATGCACATATACACCATGG - Intergenic
1008747306 6:54687858-54687880 TAAATTGCACATGTCCAGGAAGG + Intergenic
1008837081 6:55846998-55847020 AAAAAGGAAAATAACCAGCAAGG + Intronic
1010009534 6:71034462-71034484 AAAAATGATCATATGGAGCAAGG - Intergenic
1010409326 6:75543358-75543380 CAAAATCCACTTTTCCAGCAAGG + Intergenic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1012781420 6:103563252-103563274 AAAAATACACATATATAGCCAGG - Intergenic
1014493243 6:122088792-122088814 TAAAATGCTCATTGCCAGCAGGG + Intergenic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1014843185 6:126243567-126243589 AAATGTGCACATATACACCATGG + Intergenic
1015111540 6:129597343-129597365 AAAAATTCTCATCTCCAGCCTGG - Intronic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1016770873 6:147849141-147849163 AAAAATTCACATATAGAACAGGG - Intergenic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017267926 6:152472745-152472767 AAAAACCAACATATCCAGAAAGG - Intronic
1017547109 6:155464410-155464432 ATAATGGTACATATCCAGCATGG - Intergenic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1017679991 6:156853890-156853912 AAAAATGAAATTAGCCAGCATGG - Intronic
1020423638 7:8038978-8039000 AAACATGCATATAGCCAACAAGG + Intronic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1020852048 7:13366311-13366333 AATATTTCACATATACAGCACGG - Intergenic
1020987132 7:15150013-15150035 AAAAATGCAGCTAACCAGGAAGG - Intergenic
1021060881 7:16110064-16110086 AAAAATACACATATACAGTAAGG + Intronic
1021710523 7:23411719-23411741 AAAGATGCCAACATCCAGCAGGG + Intronic
1022025798 7:26446554-26446576 AAAAATCCAAATATCCATCAAGG - Intergenic
1023443318 7:40206785-40206807 GAAAATGTACATCTTCAGCACGG + Intronic
1023505421 7:40895090-40895112 GAAAATGTACATATTCATCATGG + Intergenic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024054990 7:45654355-45654377 AAAAATACACACTGCCAGCAAGG - Intronic
1024191873 7:47020394-47020416 AAAAATGCACAAACAAAGCAAGG + Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1024338625 7:48234914-48234936 CAAAATCTACATAACCAGCATGG - Intronic
1025571175 7:62570720-62570742 AATAATGAACAAATTCAGCATGG - Intergenic
1025633353 7:63298973-63298995 AAAAATGGACATGTCCGGCCAGG - Intergenic
1025649343 7:63449216-63449238 AAAAATGGACATGTCCGGCCAGG + Intergenic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1026157451 7:67839350-67839372 AAAAATGCATATATCCAGGCTGG - Intergenic
1026324479 7:69296965-69296987 AAAAATGAAAATAATCAGCAGGG + Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1028079748 7:86560383-86560405 AAAAATGCAGATTTCCAAGATGG + Intergenic
1028668160 7:93371122-93371144 AATGTTGCACATATACAGCATGG + Intergenic
1028675733 7:93458512-93458534 AAATCTGTACATCTCCAGCAGGG + Intronic
1029780756 7:102729833-102729855 AAATGTGCACATATACAACATGG + Intergenic
1030436272 7:109524952-109524974 AAAATGGCACATATACACCATGG + Intergenic
1031444397 7:121832754-121832776 AAAAATTCACAAATGCATCATGG - Intergenic
1031782195 7:125982483-125982505 AAAAACGCACATTTTCATCATGG - Intergenic
1032353167 7:131184840-131184862 AAAGATGCACACACCCAGCCAGG + Intronic
1032495574 7:132359374-132359396 AAAAATACAAAAATCCGGCATGG - Intronic
1032733237 7:134665247-134665269 CAAAGTGCACATATACACCATGG + Intronic
1033158577 7:138977575-138977597 AAAGATGCAGAAATCCAGCCTGG + Intronic
1034636877 7:152574697-152574719 AGGAATGCTCATGTCCAGCAAGG - Intergenic
1034842866 7:154415747-154415769 GAAAATGCACTTCTCCAGCCTGG - Intronic
1035785760 8:2259331-2259353 TAAAATGTACAAATCAAGCATGG - Intergenic
1035807047 8:2462385-2462407 TAAAATGTACAAATCAAGCATGG + Intergenic
1036017211 8:4798369-4798391 AAAAATGCACATATACACCATGG - Intronic
1036760267 8:11503840-11503862 AAAGATGCACTTGACCAGCAGGG - Intronic
1037914789 8:22766451-22766473 AATAATGCACATAAGCTGCATGG + Intronic
1039149825 8:34491670-34491692 AAAAAAGCAGACATCAAGCAAGG - Intergenic
1039445551 8:37628955-37628977 AAAAATCCAGACATTCAGCATGG - Intergenic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040102464 8:43517926-43517948 AAAGATGCACATGTACAGCTTGG + Intergenic
1040141848 8:43928149-43928171 AAAACGGCACATATACACCATGG + Intergenic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1040692630 8:49958245-49958267 CACAAGGCACACATCCAGCAGGG + Intronic
1041454734 8:58046093-58046115 AAAAATTCACCTAATCAGCATGG - Intronic
1041625501 8:60021140-60021162 AAAAATGTATATATACACCATGG - Intergenic
1042941424 8:74112559-74112581 AAAACAGAAGATATCCAGCATGG + Intergenic
1043310043 8:78847495-78847517 AAAACTGCACATTTTCAGGAAGG + Intergenic
1043398384 8:79859889-79859911 AAAAATGGAGATATACAGCGGGG - Intergenic
1043412825 8:80016877-80016899 AGAAAAGGACAGATCCAGCAGGG + Intronic
1043968524 8:86505630-86505652 AAAAATAAACATTTCCATCATGG - Intronic
1044176594 8:89132202-89132224 AAGAATGCACATGAACAGCAGGG + Intergenic
1044763362 8:95546449-95546471 AAGAAGGCACATATACACCATGG + Intergenic
1045019062 8:98025771-98025793 AAAAATGGACAGATCCAAAATGG - Intronic
1045188448 8:99860910-99860932 AAAATTGCACATATTCTCCATGG + Intronic
1045840177 8:106571115-106571137 AAAAAGGCAGATATCCACCAAGG + Intronic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047067983 8:121308318-121308340 ACAAGTGCACATATTAAGCAGGG - Intergenic
1047717069 8:127605348-127605370 AGAAATGCCCATATGGAGCATGG - Intergenic
1047887365 8:129266640-129266662 AAATCTGCACATATACACCATGG + Intergenic
1048232104 8:132652574-132652596 CAAAATTCACATATACACCATGG + Intronic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1048821338 8:138383353-138383375 AAAAACACACATATCTAGCAGGG + Intronic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050049436 9:1583801-1583823 AAAATGGCACATATACACCATGG - Intergenic
1050275914 9:4000070-4000092 AAAAATCCAAATATCCATGATGG + Intronic
1050573303 9:6965067-6965089 AAAAATGGAAATTTCCAGGAGGG + Intronic
1051570691 9:18555306-18555328 AAAAAGGCACAAATCCAGAGAGG - Intronic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054453578 9:65417424-65417446 CAAAATGCACAAACCAAGCAAGG - Intergenic
1055201911 9:73674142-73674164 AAAATGGCACATATCCACCATGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056707251 9:88961695-88961717 AACATTCCACATATTCAGCATGG + Intergenic
1057130711 9:92652477-92652499 AAAAATGCATATACCTAACATGG + Intronic
1057386718 9:94611456-94611478 AAAAATGCACATTCACAGCCGGG + Intronic
1057509723 9:95667842-95667864 AAAAATGCACATTTCATGCTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057731502 9:97612849-97612871 AAAAATACAAGTATCCAGCTGGG - Intronic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1058641152 9:107086814-107086836 AAAAATTCACATCTCCAGAAAGG - Intergenic
1059870142 9:118563640-118563662 AGAAATGCACATTTCCCGTAAGG + Intergenic
1060266586 9:122115251-122115273 GAAAATGGTCATATCCAGAATGG - Intergenic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1185939579 X:4300699-4300721 GAAAATGTGCATATCCACCATGG - Intergenic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1186043558 X:5508510-5508532 AAAAATGCCCACCTCCAGCCAGG - Intergenic
1186290696 X:8094565-8094587 AAAAATGCACCTGACCAACATGG - Intergenic
1187252860 X:17614603-17614625 AAACAAACACATATCAAGCATGG - Intronic
1188250957 X:27893734-27893756 AAATATCCACATAGCCATCATGG + Intergenic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188606069 X:32031469-32031491 AAAAATCCACATATTCACCAAGG + Intronic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189152695 X:38724572-38724594 AAAATGGCACATATACACCATGG + Intergenic
1189173932 X:38935304-38935326 ATAAATGCACCAATCTAGCAAGG - Intergenic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189822805 X:44886648-44886670 AAAAATACACAAAATCAGCAGGG - Intronic
1189856010 X:45225744-45225766 AAAAACCCACCTATCCTGCAAGG + Intergenic
1189896984 X:45665771-45665793 TAAAATGAACCTATCCAGCTAGG + Intergenic
1192396403 X:70786102-70786124 AATATGGCACATATACAGCATGG + Intronic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1193315245 X:80057356-80057378 AAATGTGCACATATACACCATGG - Intergenic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1194044548 X:88986116-88986138 AAATGTGCACATATACACCATGG + Intergenic
1194557343 X:95376710-95376732 AAAAATGTATATATACACCATGG + Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1194995357 X:100586345-100586367 AAAAAAGCACAAATCCAGGAAGG + Intronic
1195275818 X:103279133-103279155 AAAAATGTATATATCCAGCCTGG - Intergenic
1195466499 X:105184319-105184341 AAAAAGGCAAATATTCAGGAAGG - Intronic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196000460 X:110778880-110778902 AAATGTGCACATATACACCATGG + Intronic
1199029948 X:142985840-142985862 AATATTGCACATATACATCAGGG - Intergenic
1199835382 X:151585107-151585129 AAAAATGCACATAAAGGGCAAGG + Intronic
1199910195 X:152278467-152278489 AATATGGCACATATACAGCATGG - Intronic
1200374136 X:155761410-155761432 AATAAGGCACATATACACCATGG - Intergenic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201564778 Y:15354598-15354620 AAAAATACAAAAATCCAGCCAGG + Intergenic
1201580642 Y:15508547-15508569 AAAGTGGCACATATACAGCATGG + Intergenic
1201703250 Y:16907390-16907412 AATATAGCACATATCCACCATGG + Intergenic
1201771807 Y:17623041-17623063 CCAAATGAACAGATCCAGCATGG + Intergenic
1201829748 Y:18282945-18282967 CCAAATGAACAGATCCAGCATGG - Intergenic