ID: 966176068

View in Genome Browser
Species Human (GRCh38)
Location 3:177138889-177138911
Sequence CTCCCTAGAAGGAGTACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966176060_966176068 22 Left 966176060 3:177138844-177138866 CCCAAGAGAGCAGGGTACCATGT 0: 1
1: 0
2: 0
3: 6
4: 168
Right 966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 125
966176061_966176068 21 Left 966176061 3:177138845-177138867 CCAAGAGAGCAGGGTACCATGTG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 125
966176063_966176068 -2 Left 966176063 3:177138868-177138890 CCTGCTGACTCCTCACCCATACT 0: 1
1: 0
2: 1
3: 22
4: 203
Right 966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 125
966176062_966176068 5 Left 966176062 3:177138861-177138883 CCATGTGCCTGCTGACTCCTCAC 0: 1
1: 0
2: 2
3: 47
4: 423
Right 966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966176068 Original CRISPR CTCCCTAGAAGGAGTACTGC TGG Intronic
902359636 1:15935365-15935387 CGCCGTAGATGCAGTACTGCTGG - Exonic
903200144 1:21730317-21730339 CTCCCAAGTAGGTGGACTGCAGG - Intronic
903981971 1:27195261-27195283 CTCCCTACCTGGAGGACTGCTGG + Intergenic
905570946 1:39004958-39004980 CTCCCAAGTAGCAGTGCTGCCGG - Exonic
906908802 1:49924561-49924583 CTATCTAGAAGGCATACTGCTGG + Intronic
907402129 1:54231025-54231047 ATACCTAGGAGGAGAACTGCTGG + Intronic
908689038 1:66756619-66756641 CTACCTAGTAGGATTAATGCGGG - Intronic
919057311 1:192587107-192587129 CCTTCTAGAAGGAGCACTGCTGG + Intergenic
919937902 1:202266771-202266793 CTTCCTAGAAGGAGTAAAGAGGG - Intronic
922520837 1:226250671-226250693 CTCCCAAGAAGGTGGACTACAGG + Intronic
924660906 1:246015911-246015933 ATACCTAGAAAGAGAACTGCTGG + Intronic
1065197419 10:23279975-23279997 CTCCTGAGTAGGAGGACTGCAGG + Intronic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1076208093 10:128619120-128619142 CTCCCAGGAAGGAGGACAGCTGG - Intergenic
1076706730 10:132306456-132306478 CTGCCTAGAAGGAGGGCTGAAGG - Intronic
1078103814 11:8345989-8346011 CTCCCTTGAAGGATTTCTGTAGG - Intergenic
1082822717 11:57555141-57555163 CTACCCAGAAGTAGAACTGCTGG - Intronic
1088173572 11:107024051-107024073 CTTACTATAAGGAGAACTGCCGG - Intergenic
1089338308 11:117740827-117740849 ATCTCCAGAAGGAGTACAGCTGG + Intronic
1091190550 11:133691913-133691935 CTACCTAGAAGGGGAATTGCTGG - Intergenic
1091257305 11:134200705-134200727 ATACCTAGGAGGAGAACTGCTGG - Intronic
1094154021 12:27318517-27318539 ATCCCTAGAAGTAGAACTTCTGG - Intronic
1097963808 12:65557966-65557988 TTTCCTAGAAGGCCTACTGCTGG + Intergenic
1099294281 12:80810603-80810625 CTCCCCAGAAGCAGAATTGCTGG + Intronic
1100441807 12:94624260-94624282 ATACCTAGAAGGAGTGTTGCTGG - Intronic
1101360685 12:104024029-104024051 CTACCTAGAAGTGGTATTGCTGG + Intronic
1101973140 12:109331581-109331603 CACCCTGGAAGGAGGACTTCGGG + Intergenic
1106140431 13:27006688-27006710 CTCCTTAGCAGGAGCACTCCAGG - Intergenic
1106523779 13:30521727-30521749 ATCCCTAGAAGTAGAACTGCTGG + Intronic
1106632956 13:31496001-31496023 CTGCCTAGAAGTAGTGCAGCAGG + Intergenic
1107315299 13:39125084-39125106 CTCCTTGGAAGGAGTAATTCAGG + Intergenic
1107827803 13:44345396-44345418 ATTCCTAGAAGTAGGACTGCCGG + Intergenic
1108357514 13:49641217-49641239 ATCCCTAGAAGAAGGACAGCAGG + Intergenic
1109064039 13:57661017-57661039 ATCCCTAGAAGTAGGATTGCTGG + Intronic
1112033524 13:95477464-95477486 CCCCCTGGAAGGAGTCCTCCGGG - Intronic
1112611899 13:100963495-100963517 ATACCTAGAAGTAGAACTGCTGG + Intergenic
1116899840 14:50350889-50350911 CTCCCCAGAAGGAGTGCCTCTGG - Intronic
1117448008 14:55823305-55823327 CTCCCAAGCAGGTGAACTGCGGG - Intergenic
1119437131 14:74604974-74604996 CTCCCTAGAAGGGCTTCTCCTGG + Intronic
1121377279 14:93424340-93424362 ATACCTAGAAGGAGGATTGCTGG - Intronic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1125556183 15:40587045-40587067 CTCCCTAGTAGGTGGACTACAGG - Intergenic
1125924834 15:43554355-43554377 TTCCCCAGTTGGAGTACTGCTGG + Intronic
1126228917 15:46302784-46302806 CTCTCAAGAAAAAGTACTGCAGG - Intergenic
1126445920 15:48744141-48744163 TTCCCTAGAAGAACTACTGCTGG + Intronic
1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG + Intronic
1129365846 15:75053891-75053913 ATCCCTAGAAGTAGAATTGCTGG - Intronic
1130289147 15:82581459-82581481 ATACCTAGAAGGAGAATTGCTGG + Intronic
1133199222 16:4192302-4192324 CTCCCATGTAGGAGCACTGCTGG + Exonic
1137740830 16:50771516-50771538 CTCCCTAGGAGTAGAATTGCTGG + Intronic
1137860821 16:51844889-51844911 ATTCCTAGAAGTAGTATTGCTGG - Intergenic
1138481418 16:57305767-57305789 CACCCTAGAAGGAGAACCCCAGG + Intergenic
1139362285 16:66407221-66407243 ATCCCTAGAAGGGGGATTGCTGG - Intergenic
1141448153 16:84077100-84077122 CTCCCAAGTAGGTGGACTGCAGG - Intronic
1141966422 16:87447717-87447739 TTCCCTAGGACGAGAACTGCAGG + Intronic
1142075573 16:88115719-88115741 GCCCCCAGAAGGAGTACGGCTGG - Intronic
1142317526 16:89357500-89357522 CTACCCAGAAGGGGAACTGCTGG - Intronic
1143635597 17:8162459-8162481 CTCCCGAAAAGGAGGACTGGAGG - Intronic
1146660454 17:34662169-34662191 CTACCTAGAAGCAGCAGTGCTGG - Intergenic
1149781744 17:59403037-59403059 CTCCCAAGAAGCTGGACTGCAGG - Intergenic
1155387846 18:25300076-25300098 GTTCCAAGAAGGAGTACTTCAGG - Intronic
1157392307 18:47312966-47312988 CTCCCTGAAAGGAGGACTGCTGG + Intergenic
1159990901 18:74906118-74906140 ATGCCTACAAGGGGTACTGCAGG - Intronic
1162921795 19:13907286-13907308 CTCCCAAGTAGTAGTACTACAGG - Intronic
1165907677 19:39203703-39203725 CTCCCTAGAACCAGTCCTGGAGG - Intronic
928240876 2:29584646-29584668 TTCTATAGAAGGAGTTCTGCAGG - Intronic
929603534 2:43219752-43219774 CTCCCCAGGAGGAGCCCTGCAGG - Intergenic
931505986 2:62926818-62926840 CTCAGTAGTAGGAGGACTGCTGG - Intronic
933092154 2:78134946-78134968 CTACCTAGAAGTGGTATTGCTGG + Intergenic
935362631 2:102260316-102260338 ATGCCTAGAAGTAGAACTGCAGG - Intergenic
942305062 2:174599293-174599315 CTCCCCAGTAGGAGCACTTCTGG - Intronic
945596170 2:211796473-211796495 ATACCTAGAAGTAGTACTGCTGG + Intronic
948378228 2:237536390-237536412 CTACCTTGCAGGGGTACTGCAGG - Intronic
948490872 2:238312289-238312311 CTACCCAGAAGTAGGACTGCTGG - Intergenic
1172254744 20:33507812-33507834 ATTCCTAGAAGTAGAACTGCTGG + Intronic
1173642357 20:44612785-44612807 ATCCCTAGAAGTAGAACTGCTGG - Intronic
1173675505 20:44831490-44831512 ATCCCTAGAAGTAGAATTGCGGG - Intergenic
1173896550 20:46555419-46555441 CTCCCCAGAAGGAGAGCTGAGGG + Intergenic
1178526619 21:33335037-33335059 GTCACCACAAGGAGTACTGCAGG + Intronic
1179575869 21:42308166-42308188 CCCCCAAGAAGGAGGACTGAGGG + Intergenic
1180098310 21:45571971-45571993 CTCCCTGGAAGGAAAGCTGCAGG - Intergenic
1181899401 22:26140342-26140364 GTACATAGAAAGAGTACTGCAGG + Intergenic
1182562926 22:31175618-31175640 AACCCTAGAAGTAGAACTGCAGG - Intronic
1183673519 22:39287043-39287065 TTCCTTAGAAGGAGAATTGCTGG - Intergenic
1184930523 22:47677768-47677790 CTCTCTACCAGGAGTGCTGCTGG - Intergenic
949100961 3:144888-144910 CTCCCTAGGAGCAGGACTACAGG + Intergenic
950538644 3:13596496-13596518 ATCCCTACAAGGAGAATTGCAGG + Intronic
953473246 3:43184474-43184496 CTCCCTAGAAGGAGCTCTTCGGG - Intergenic
953732925 3:45465423-45465445 ATCCCTAGAAGGACTTCTGAGGG - Intronic
953762588 3:45701816-45701838 CTCCCTAGAAGTGGAACAGCTGG - Intronic
954046134 3:47932435-47932457 ATCCCTAGGAGTAGAACTGCTGG + Intronic
963580139 3:147115713-147115735 GTCTCCAGAAGGAGTACAGCTGG + Intergenic
966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG + Intronic
966742524 3:183247502-183247524 TTCCCAAGAAAGAGTACTACTGG + Intronic
968573765 4:1355541-1355563 CTCCCTAGAAGGAGTCACGGGGG - Intronic
969534301 4:7746511-7746533 AACCCTAGAAGGAGCACAGCAGG - Intergenic
972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG + Intergenic
980009303 4:127578721-127578743 CTGCCTGGAGGGAGTCCTGCTGG + Intergenic
988478273 5:31607407-31607429 CCCCTTAGAAGCAGTAATGCTGG + Intergenic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
999316811 5:150589579-150589601 CTTCCTAGAAGTGGTATTGCTGG + Intergenic
999388408 5:151172285-151172307 TTCCTTAGAAGGAGAACTGCTGG - Intergenic
1005705101 6:28443537-28443559 CTTCCTAGAAGGAACACAGCCGG - Intergenic
1009935347 6:70227610-70227632 ATTCCTAGAAGTAGAACTGCTGG - Intronic
1010085552 6:71913625-71913647 CTCCCTTTAAGGAGTAAAGCAGG + Intronic
1013681549 6:112529707-112529729 CACCCTAGAAGGAGTAAAGGAGG - Intergenic
1015207870 6:130661159-130661181 CTCCCTGGAAGGAGAACTCATGG - Intergenic
1015848861 6:137551294-137551316 ATCGCTGGAAGAAGTACTGCTGG - Intergenic
1022827669 7:34032848-34032870 CTCTCTAGAATCAGTCCTGCTGG - Intronic
1023803329 7:43853617-43853639 CTACCTAGAAGGAATTCTGCCGG + Intergenic
1026285403 7:68958307-68958329 CTCCCTAGTAGCAGGACTACAGG - Intergenic
1027604388 7:80282992-80283014 CTCACTATAAGGAGAACAGCAGG - Intergenic
1028137491 7:87237405-87237427 CTCCCGAGTAGCAGGACTGCAGG - Intergenic
1029292838 7:99515709-99515731 CTCCCAAGGAGCAGTACTACAGG - Intronic
1032992400 7:137408289-137408311 CTCTCTCGAAGGAGTAGTGAGGG + Intronic
1038193868 8:25348501-25348523 CTCCCTAGAAGGTGGGCTCCTGG - Intronic
1038320568 8:26522361-26522383 CTGCCTAGAAGTAGAATTGCTGG + Intronic
1038621488 8:29147460-29147482 CTCCTGAGAAGCAGAACTGCCGG - Exonic
1039833740 8:41238239-41238261 CTTCCCACAAAGAGTACTGCAGG - Intergenic
1044134215 8:88564243-88564265 ATACCTAGAAGCAGAACTGCTGG - Intergenic
1048662505 8:136621104-136621126 TTCTTGAGAAGGAGTACTGCTGG + Intergenic
1049281610 8:141752268-141752290 CTTTCTAGAAGCAGTATTGCTGG - Intergenic
1049793717 8:144485915-144485937 CTCCATAAATGGAGTGCTGCAGG + Intronic
1050290316 9:4147663-4147685 CTCCCTTCAAGGGGAACTGCTGG + Intronic
1051368893 9:16341548-16341570 GTCCCTAGAAGCAGAATTGCTGG + Intergenic
1057582963 9:96303752-96303774 CACCCTAGAAGCAGAATTGCTGG + Intergenic
1059514787 9:114882960-114882982 CTCCCAAGTAGCAGTGCTGCCGG - Intergenic
1060154772 9:121311963-121311985 TTTCCTAGAAGGAGGATTGCTGG + Intronic
1060201325 9:121653166-121653188 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201330 9:121653196-121653218 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201335 9:121653226-121653248 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201340 9:121653256-121653278 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1186106296 X:6210554-6210576 CTACCCAGAAGGAATGCTGCTGG - Intronic
1195568582 X:106374016-106374038 CTCCCAAGAAGCTGTACTACAGG - Intergenic
1200132438 X:153858165-153858187 TGCCCTAGAAGGAGCAGTGCTGG - Intergenic
1200324063 X:155218984-155219006 CTTCCTAGAAGGGTCACTGCAGG - Intronic
1201491209 Y:14543544-14543566 CTACCCAGAAGGAATGCTGCTGG + Intronic