ID: 966176991

View in Genome Browser
Species Human (GRCh38)
Location 3:177149141-177149163
Sequence CACCGGGAAATGGCTAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966176991_966176996 4 Left 966176991 3:177149141-177149163 CCAATGCTAGCCATTTCCCGGTG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 966176996 3:177149168-177149190 CAATGCGGAGTACCTGTCAATGG 0: 1
1: 0
2: 0
3: 4
4: 40
966176991_966176998 18 Left 966176991 3:177149141-177149163 CCAATGCTAGCCATTTCCCGGTG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 966176998 3:177149182-177149204 TGTCAATGGAACAGCACCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966176991 Original CRISPR CACCGGGAAATGGCTAGCAT TGG (reversed) Intronic
900331424 1:2136580-2136602 CACCAGGAAATGGGGAGCCTAGG + Intronic
906105252 1:43287742-43287764 TGCCTGGAAATGGCTAACATGGG - Intergenic
919722694 1:200856328-200856350 CACACAGAAATGGCCAGCATTGG - Intronic
920494422 1:206444562-206444584 CACCAGGAACTGGCCAGCCTTGG + Intronic
921166766 1:212513566-212513588 CACCGTGAAGTGGCTGGCAGCGG + Intergenic
921271697 1:213475758-213475780 CACCGGGAAATGGCCATCTTTGG + Intergenic
1075891230 10:125953144-125953166 CACTGGGAACTGGCTAGAAATGG - Intronic
1080932354 11:36825143-36825165 AAGCGTCAAATGGCTAGCATGGG - Intergenic
1082883630 11:58062022-58062044 CACCCAGAAATGACTAGTATAGG + Intronic
1089561371 11:119344947-119344969 CACCAGGAGGTGGCTGGCATTGG + Exonic
1106336658 13:28789429-28789451 CACCCGGAAAGGGCAAGGATGGG - Intergenic
1113467315 13:110521275-110521297 CAGCTGGAAGTTGCTAGCATAGG + Intergenic
1114733361 14:25018202-25018224 CCACGGGCAATGGCTGGCATTGG - Intronic
1116700539 14:48236232-48236254 CACCTCGAAATAGCTACCATGGG + Intergenic
1117072753 14:52070657-52070679 CACCAGGAAATGGGGATCATTGG - Intergenic
1119145657 14:72311579-72311601 CACCAGGAAATGTCTAGCCTGGG - Intronic
1128611049 15:69074078-69074100 CAGCGGGAAAAGGCGAGAATGGG - Intergenic
1131768873 15:95712827-95712849 CACAGGGAAATGGGGAGGATGGG - Intergenic
1132471816 16:108534-108556 CACAGGTAAATGGTTAGCACTGG + Intronic
1132790954 16:1687475-1687497 CACCTGGAAATGGCTCAGATAGG - Intronic
1137032711 16:35538992-35539014 GACAGGGAAATGGCTAAAATAGG + Intergenic
1140522557 16:75594244-75594266 CTCCAGGAATTGGCTAGCCTTGG + Intergenic
1140959717 16:79900186-79900208 CTCAGGGAAATGGCTGACATTGG + Intergenic
1141469594 16:84229431-84229453 AACAGGGAAATGACTAGCACAGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
932875540 2:75447316-75447338 TACTGGGAGCTGGCTAGCATCGG + Intergenic
933040338 2:77457166-77457188 CTCTGGGAAATGACTAGGATTGG - Intronic
935028531 2:99300405-99300427 CACGGGGAAATCTCCAGCATAGG - Intronic
939508065 2:143073637-143073659 TACCAGGAAATGGGTATCATTGG - Intergenic
944860530 2:203811727-203811749 CACCAGGAAGTGGGTGGCATGGG + Intergenic
946373844 2:219296676-219296698 CACGGGGAAATGGAGTGCATAGG + Intronic
1170348074 20:15409088-15409110 CAACCAGAACTGGCTAGCATGGG - Intronic
1175316998 20:58055358-58055380 CACCAGGAAGAGCCTAGCATTGG - Intergenic
951710821 3:25583683-25583705 CACCGAGCAAAGGCTAGGATGGG - Intronic
957574946 3:81995483-81995505 AACAGGGAAATGGCTGGCAAAGG - Intergenic
962352549 3:134666436-134666458 CACCAGGATATGCCAAGCATTGG + Intronic
966176991 3:177149141-177149163 CACCGGGAAATGGCTAGCATTGG - Intronic
967088863 3:186118141-186118163 GACTGGGAAAGGGCTAGAATGGG + Intronic
969240832 4:5896205-5896227 CACCGGGAAGTGACTAACCTGGG + Intergenic
982827288 4:160017301-160017323 CACTGAGAAATACCTAGCATTGG - Intergenic
987684374 5:21178381-21178403 CAGTGGGAAATGGCTGGTATTGG + Intergenic
997437051 5:133883237-133883259 CATCGGGAAATTGATAGCTTTGG - Intergenic
1002596163 5:180324979-180325001 CACTGGGAAAGGGCTAGATTTGG - Intronic
1008523474 6:52384425-52384447 CAGAGTGAAATGGCTAGCACTGG + Intronic
1013442247 6:110182048-110182070 CACCGTGAAATGGTTAGCACAGG + Intronic
1022464633 7:30645290-30645312 CACTGGAAAAGGGCCAGCATGGG - Intergenic
1029258876 7:99287835-99287857 CACCCGGAAAAGGCTGGCACTGG + Intergenic
1031083160 7:117277944-117277966 CACCAGGAGATGGATAGAATAGG + Exonic
1034266406 7:149783192-149783214 CACCTGGAACTTGCTAGCAAAGG - Intergenic
1035412229 7:158654155-158654177 CACAGGGAAAGGGTTAGCACAGG - Intronic
1038611196 8:29061489-29061511 CCCCGGGAAGTGGCTAGAAGAGG - Intronic
1040877196 8:52166254-52166276 CTCTGGGAATTGGCTAGCCTGGG - Intronic
1041132866 8:54721406-54721428 CAGTGGGAAATAGCTAGCAGGGG + Intergenic
1045239487 8:100386604-100386626 CACCAGGACAGTGCTAGCATTGG + Intronic
1055933698 9:81585610-81585632 CACCGGGGAGTGGCTGGCAGTGG - Exonic
1056458670 9:86788208-86788230 AGCAGGAAAATGGCTAGCATGGG - Intergenic
1195877474 X:109557196-109557218 CACCAGCAAAAGGCCAGCATGGG - Intergenic