ID: 966177731

View in Genome Browser
Species Human (GRCh38)
Location 3:177157358-177157380
Sequence GACTAATGACTGCTGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966177731_966177734 6 Left 966177731 3:177157358-177157380 CCATTCTTCAGCAGTCATTAGTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 966177734 3:177157387-177157409 CCCTCTCACTACAGATTTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966177731 Original CRISPR GACTAATGACTGCTGAAGAA TGG (reversed) Intronic
901742765 1:11353071-11353093 GACTGATGAGTGTTGGAGAATGG + Intergenic
902862691 1:19257520-19257542 GAGTAAGTACTGCTGAGGAACGG + Exonic
905491431 1:38346922-38346944 GACTATGGACTGCTCCAGAAAGG - Intergenic
909482764 1:76143281-76143303 GCCAAATGACTGGTGAGGAATGG - Intronic
910742370 1:90533957-90533979 GTCTATTGATGGCTGAAGAAGGG - Intergenic
911674612 1:100645644-100645666 AACTAATTACTCCTGAAGACTGG - Intergenic
914397776 1:147287342-147287364 GGCAAATGACTGCGGAAGGACGG - Intronic
920719077 1:208370096-208370118 GACTACTGACTGCTGCTGAGGGG + Intergenic
922328837 1:224556007-224556029 GAGTGAAGACTGCTGAGGAAGGG + Intronic
923296922 1:232603266-232603288 GACTAGGGACAGCTGGAGAAAGG + Intergenic
924464813 1:244290412-244290434 GAGCAATGCCTGCTGAGGAAGGG - Intergenic
1062867473 10:868163-868185 GAGTAATTAATGCTGGAGAAGGG + Intronic
1064344423 10:14518293-14518315 GACTGATGGCTGCTGCTGAAGGG + Intergenic
1068364803 10:56033731-56033753 GAATCATGACTGCTGATGAAAGG - Intergenic
1069988295 10:72298705-72298727 GGTTAATGAATGCTGAAGACCGG - Intergenic
1070047937 10:72857992-72858014 AACTTATGACAACTGAAGAATGG + Intronic
1071356183 10:84798588-84798610 GAAGAACGACTGCTGGAGAATGG + Intergenic
1073226158 10:101921347-101921369 GACTACTGACTGGAAAAGAAGGG + Intronic
1073859103 10:107716630-107716652 AACTGATGACTGCAGAAGAGTGG + Intergenic
1083064311 11:59908351-59908373 GACTAATAACAGCAGAAGAAAGG - Intergenic
1091463665 12:665004-665026 GACTGAGGGCTGCTGACGAAGGG + Intergenic
1092568174 12:9691641-9691663 GACCAATGGCTGTTGAAGAGCGG - Intronic
1093009751 12:14094066-14094088 GACTAATGCCTGTTGTAAAAGGG - Intergenic
1093410419 12:18858594-18858616 GAACAATGCCTGCTGAAGAGTGG + Intergenic
1093960123 12:25263474-25263496 CACTTATGATTTCTGAAGAAGGG - Intergenic
1094709527 12:32947511-32947533 GGCTAATGACTGCTGAAACAAGG + Intergenic
1097370151 12:58768566-58768588 GATTAATGACCTCTGAAGAAGGG + Intronic
1098807726 12:75041163-75041185 GATTATTGACTGCTGAGAAAGGG - Exonic
1099834462 12:87890622-87890644 GAATAATGGTTGCTGAATAATGG - Intergenic
1100881324 12:99020256-99020278 GAATGGTGACTGCTGAGGAAGGG - Intronic
1101213037 12:102553671-102553693 GAACAATGACTGGTGAACAATGG - Intergenic
1101356319 12:103980909-103980931 GACTAATGGCTGCTTACAAAGGG + Exonic
1101792436 12:107939888-107939910 AACTAATCACTCCTGAAGACAGG + Intergenic
1103428149 12:120856753-120856775 AACTACTGACTGCTAAAGACTGG + Intronic
1107660976 13:42638922-42638944 GACTAAGGACTACAGATGAAAGG - Intergenic
1107812570 13:44214475-44214497 GTCTAATGATTTCTGAACAAAGG + Intergenic
1111012621 13:82330986-82331008 GACTACTCCCTGCTGAAGAGGGG - Intergenic
1112603896 13:100884579-100884601 GACTGTTGACTGCAGAAGAGAGG - Intergenic
1112825246 13:103384564-103384586 GACAAGTGACTGCTGTGGAAGGG + Intergenic
1112909267 13:104461654-104461676 AACTAATGAATGCTGAATTATGG - Intergenic
1113553675 13:111214010-111214032 GTGTAATGACTGCTGAAGAATGG + Intronic
1114809253 14:25877059-25877081 GAATAATGACTGGGCAAGAAAGG - Intergenic
1115599728 14:34943907-34943929 GATTAAATACTGCTAAAGAAAGG + Intergenic
1117522582 14:56565690-56565712 GACTAAGGACTGATGGAGGATGG + Intronic
1120421622 14:84293194-84293216 GAGTAAGGAGTGCTGGAGAAAGG - Intergenic
1124826011 15:33096516-33096538 TACTAATGACTGGTGGAGGAAGG - Intronic
1126783222 15:52156038-52156060 GACTAATGAATGCAGAGGGAAGG - Intronic
1127236945 15:57064193-57064215 GGCTGATGACTGTTGAAGCAAGG - Intronic
1127613031 15:60655708-60655730 TACTCATACCTGCTGAAGAAGGG + Intronic
1130911814 15:88276055-88276077 GAATAATGAATGCTGCAGAGAGG - Intergenic
1134344068 16:13373067-13373089 GACTACTAACTACTGTAGAAAGG + Intergenic
1144139000 17:12328747-12328769 GGCTAAGCACAGCTGAAGAAAGG - Intergenic
1146158516 17:30545512-30545534 GAATGATGACTGCTGAAGGTGGG - Intergenic
1146777124 17:35629869-35629891 GACTGCTGACTGATGAAGCAGGG - Intronic
1147817583 17:43221211-43221233 GACTTATCACTGCTGAATGAGGG + Intergenic
1148394306 17:47295910-47295932 GGCCAATGACTGATGGAGAAGGG + Intronic
1149445030 17:56706703-56706725 GGCTAATGACTGATGAAGGAAGG + Intergenic
1149626011 17:58081788-58081810 AACTAAGGACTGTTGGAGAAAGG + Intergenic
1151548974 17:74810463-74810485 CACTAATCACTGCTGCAGAGAGG + Intronic
1151777654 17:76218024-76218046 CACTAATGAATGCTTAAAAATGG + Intronic
1152182819 17:78835114-78835136 GAATCATGCCTGCTGCAGAATGG - Intronic
1152848748 17:82618792-82618814 TACTAATAAATGCTGAAGCAGGG + Intronic
1153222268 18:2872140-2872162 GAATACTGACGGCTCAAGAAAGG + Intronic
1154135931 18:11778138-11778160 GAATAGTGACTGTTGAGGAAGGG + Intronic
1158705066 18:59785071-59785093 GACTAATGGGTGGTGAAGAATGG - Intergenic
1160251584 18:77207967-77207989 CACTAGTGACTGCAGAAGCAAGG - Intergenic
1164598139 19:29543639-29543661 AATTAATGACTGCTCAAGGAAGG - Intronic
925880510 2:8348728-8348750 GACAAATGAGTGTTGCAGAATGG + Intergenic
926779256 2:16452333-16452355 GAGTAGTGGCTGCTGAATAAAGG + Intergenic
928094293 2:28394269-28394291 GAGTTATGACTGATGGAGAACGG - Intronic
929316877 2:40489892-40489914 GACTAATGGCTTCTTAATAAGGG - Intronic
930604127 2:53475036-53475058 TACTAATGACTGCAGAACGATGG - Intergenic
931141458 2:59462969-59462991 CAGCAATGACTGCTGAAGGAAGG - Intergenic
932071275 2:68622842-68622864 GTCTATTGACTGATGATGAACGG - Intronic
933863075 2:86489318-86489340 GATTAATCACTCCTGAAGATCGG + Exonic
934578908 2:95422558-95422580 GACTAATAAATACTGAAGATTGG + Intergenic
934600539 2:95654145-95654167 GACTAATAAATACTGAAGATTGG - Intergenic
935870915 2:107448646-107448668 GACTAAATAATGCAGAAGAAAGG + Intergenic
939279734 2:140047281-140047303 GACCAATTACTTCTGAATAATGG + Intergenic
939851858 2:147313835-147313857 AAAGAATGACAGCTGAAGAAAGG + Intergenic
940141010 2:150490470-150490492 GACTAGGGCCTGCTGAAGGAGGG + Intronic
942153235 2:173099636-173099658 AAATAATTACAGCTGAAGAATGG - Intronic
943139164 2:183957442-183957464 GTTTGATGACTGCTGAACAATGG - Intergenic
943990426 2:194682825-194682847 GACTAATGATGGCATAAGAAGGG + Intergenic
945818216 2:214631626-214631648 GACTGATGACTTGTGATGAAGGG + Intergenic
945872401 2:215242235-215242257 GACTAATGTCTGTTTAGGAATGG - Intergenic
947248107 2:228072607-228072629 CCCTAATGACTTCTGAAGATAGG + Intronic
948164786 2:235852572-235852594 GAATAGAGACTGCTGAAGTAAGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1171472066 20:25380091-25380113 GATTAAACACTGCTAAAGAAAGG - Intronic
1177266003 21:18784865-18784887 GACAAATGATTTCTGAAGATTGG + Intergenic
1177631786 21:23738274-23738296 GCCACATGACTCCTGAAGAAGGG - Intergenic
1181481721 22:23204109-23204131 GACTAGTCAGTGCTGAAGAAGGG - Intronic
1183626391 22:39005262-39005284 GGCTGGTGCCTGCTGAAGAATGG + Intergenic
954180711 3:48879376-48879398 GAATCATGACTCCTGGAGAACGG - Exonic
957439963 3:80232877-80232899 GACTAATGTTTGCTGAAGAAGGG - Intergenic
960147785 3:114221470-114221492 GAATAAGGCCTGCAGAAGAAAGG - Intergenic
961813448 3:129534959-129534981 GACTAGCAACTGCTGAAGATGGG - Exonic
962061155 3:131929157-131929179 GACTGATGATTGATGAAGAAAGG - Intronic
962807333 3:138936934-138936956 GACTAATCACTTCTGTAAAATGG + Intergenic
964470246 3:157045498-157045520 GATTACTGACTGCTGCAGCAGGG - Intronic
965062741 3:163804041-163804063 ATATAATGACAGCTGAAGAAAGG + Intergenic
966177731 3:177157358-177157380 GACTAATGACTGCTGAAGAATGG - Intronic
970877402 4:20887147-20887169 GACTGAGAACTACTGAAGAAAGG + Intronic
971731767 4:30393097-30393119 GACCAATGACTGCCTAAGACAGG + Intergenic
974838865 4:67279843-67279865 ATATAATGACAGCTGAAGAAAGG - Intergenic
976498566 4:85759244-85759266 TAATAATGACTGTAGAAGAAAGG + Intronic
979720736 4:123897223-123897245 TACAGATGACTGCTGAATAAGGG + Intergenic
981958856 4:150511201-150511223 GACTAATGACAGCTGTTGAGGGG - Intronic
982839879 4:160170977-160170999 GATTAATGAGTGCATAAGAATGG - Intergenic
985338272 4:188919723-188919745 GCCAAATGTCTTCTGAAGAAAGG + Intergenic
988109001 5:26790920-26790942 GACTAATCACTTCTGAAGACAGG + Intergenic
988952121 5:36273749-36273771 GATTAATGACTACAGTAGAAAGG - Intronic
994431291 5:99664844-99664866 GAATAAGGATTCCTGAAGAAAGG + Intergenic
995883032 5:116863977-116863999 TATAAATGACTTCTGAAGAAGGG + Intergenic
998771424 5:145550124-145550146 GCCAAATTACTGCTGAAGAAGGG + Intronic
1000253588 5:159517638-159517660 GAAGAGTGACCGCTGAAGAAAGG + Intergenic
1001004831 5:168040965-168040987 GACTAATGGCTGCTTACAAAGGG + Intronic
1002318037 5:178357041-178357063 GTCTAAAGTCTGCAGAAGAAAGG + Intronic
1003663822 6:8089839-8089861 GAGAAGTCACTGCTGAAGAAGGG + Intronic
1004735254 6:18399509-18399531 GACTGAAGAATGCTGAAGACAGG + Exonic
1007643773 6:43364733-43364755 AACTATTGAGTGCTGAGGAAGGG - Intronic
1008048566 6:46876259-46876281 GATGAATGACTGCAGAACAATGG - Intronic
1009386774 6:63093979-63094001 CACTAATTGCTGCTGAAGAGTGG - Intergenic
1010642439 6:78345312-78345334 GTCTGATGACTTCTGAAGCAGGG + Intergenic
1010843397 6:80675778-80675800 GCCTATTGATTCCTGAAGAATGG - Intergenic
1011404204 6:87000277-87000299 GATCAATGACTGCTGAAAAAGGG + Intronic
1011912280 6:92455641-92455663 GAATAATGAATTCTGAATAATGG + Intergenic
1011922257 6:92594153-92594175 AACTAATGAATACAGAAGAATGG + Intergenic
1012013100 6:93817390-93817412 GAATAACTACTGCTTAAGAAAGG + Intergenic
1012595338 6:101031973-101031995 GAGTACAGACTGCAGAAGAATGG - Intergenic
1013205585 6:107942301-107942323 TAATACTGGCTGCTGAAGAATGG - Intronic
1014536261 6:122616542-122616564 CACTAATGACTCCTAAAGATAGG - Intronic
1018920009 6:168165912-168165934 AACTAAAGTCTGCTGAAGATTGG + Intergenic
1021784447 7:24138022-24138044 AACTAATGATTGCTGAATTAAGG - Intergenic
1022267770 7:28774302-28774324 GACAAATGAATGCAGAAAAATGG - Intronic
1023247689 7:38223116-38223138 GACTTACAACTGTTGAAGAAAGG + Intronic
1024178058 7:46861320-46861342 ATCTAATTCCTGCTGAAGAATGG - Intergenic
1024843786 7:53618828-53618850 GAAGAATGACTGCTGAGCAAAGG - Intergenic
1027733701 7:81906593-81906615 CCCTAATGATTGCTGAAGAGGGG + Intergenic
1027903054 7:84142973-84142995 GATTAGTGAATGATGAAGAAGGG - Intronic
1029296903 7:99548390-99548412 GAATAATGACTCCTGAATCAAGG - Exonic
1029352389 7:100023505-100023527 GAATGATGACTGCTGAATCACGG + Exonic
1030954017 7:115828343-115828365 GACTAATGCCTGCTTAAGTAGGG - Intergenic
1031405149 7:121376364-121376386 GAGGAATCACTGATGAAGAAGGG + Intronic
1033496853 7:141907645-141907667 GTGTAATGACTGCTGGAGTAAGG - Intergenic
1034221593 7:149450691-149450713 CACTAATGACTGCTTGACAAGGG + Intronic
1034580004 7:152033816-152033838 GCAGAATGACAGCTGAAGAAAGG - Intronic
1038634024 8:29271084-29271106 GACTAATGACAGGTGGAGAAGGG - Intergenic
1038943624 8:32332916-32332938 GACTAAAGCATTCTGAAGAAAGG + Intronic
1044478585 8:92657570-92657592 GACTAATTTCTCCTGAGGAATGG - Intergenic
1046968895 8:120198310-120198332 AACTAATGATTGCAGAATAAGGG - Intronic
1047436165 8:124837008-124837030 GAGAGATGACTACTGAAGAATGG - Intergenic
1047978046 8:130151070-130151092 AACAAAAGATTGCTGAAGAAGGG + Intronic
1050934821 9:11382372-11382394 GAGTGGTGATTGCTGAAGAATGG + Intergenic
1051745844 9:20293851-20293873 GACTGATCTCTGCTGAAGAAAGG - Intergenic
1053077167 9:35142718-35142740 GACTTAGGACTTCTTAAGAAAGG + Intergenic
1055330047 9:75174239-75174261 GAATAATAATTACTGAAGAATGG - Intergenic
1056792117 9:89632840-89632862 GATTAATGCCTGTAGAAGAAAGG + Intergenic
1057224391 9:93281994-93282016 GAACAATGACTGCAGATGAAAGG + Intronic
1058717290 9:107734399-107734421 GTCCAATGACTGCTGAGGTATGG - Intergenic
1059125579 9:111681591-111681613 AACTAATGAGTTCTGAATAAAGG + Intergenic
1062066361 9:134528733-134528755 GATTCATGACTGCTGAGGGAAGG - Intergenic
1186290041 X:8087120-8087142 GAATAATGACTGTTGAACATTGG + Intergenic
1193701701 X:84770533-84770555 GAATAATGACTATTAAAGAAAGG - Intergenic
1194691309 X:96989323-96989345 GAGAAATGGCTGCTTAAGAATGG - Intronic
1197814618 X:130484321-130484343 GAGAAATGACTCCTGAACAAAGG - Intergenic
1198561249 X:137852368-137852390 CACTAATGACTGCTACAGAGCGG + Intergenic
1198660957 X:138966939-138966961 GAATGATGACTGCTGAGCAAAGG - Intronic
1201530521 Y:14985924-14985946 ATCGAATGACAGCTGAAGAAAGG + Intergenic