ID: 966185220

View in Genome Browser
Species Human (GRCh38)
Location 3:177221062-177221084
Sequence GTCTAGAAGAGGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966185220_966185228 15 Left 966185220 3:177221062-177221084 CCTTCCCCCTTCCTCTTCTAGAC No data
Right 966185228 3:177221100-177221122 AGTTCCTCTGTTTGAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966185220 Original CRISPR GTCTAGAAGAGGAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr